Skip to main content
Download PDF

Author Correction: Pooled extracellular receptor-ligand interaction screening using CRISPR activation

Genome Biology volume 23, Article number: 224 (2022) Cite this article

The Original Article was published on 26 November 2018

Correction: Genome Biol 19, 205 (2018)

https://doi.org/10.1186/s13059-018-1581-3

Following the publication of the original paper [1], the authors reported a typographical error in the sequence of SAMlibrary-HiSeq_50bp-F1 used for NGS library preparation (as listed in Table S1).

The sequence for Primer 1: SAMlibrary-HiSeq_50bp-F1 has two extra bases inserted (in bold) ACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTTGTGGAAAGGACGAAACA

The correct sequence should be:

ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACA

Reference

  1. Chong ZS, Ohnishi S, Yusa K, et al. Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Genome Biol. 2018;19:205. https://doi.org/10.1186/s13059-018-1581-3.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Cell Surface Signalling Laboratory, Wellcome Sanger Institute, Cambridge, CB10 1SA, UK

    Zheng-Shan Chong & Gavin J. Wright

  2. Stem Cell Genetics Laboratory, Wellcome Sanger Institute, Cambridge, CB10 1SA, UK

    Shuhei Ohnishi & Kosuke Yusa

Authors
  1. Zheng-Shan Chong
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Shuhei Ohnishi
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Kosuke Yusa
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Gavin J. Wright
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Gavin J. Wright.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Chong, ZS., Ohnishi, S., Yusa, K. et al. Author Correction: Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Genome Biol 23, 224 (2022). https://doi.org/10.1186/s13059-022-02797-6

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s13059-022-02797-6

Genome Biology

ISSN: 1474-760X

Contact us