Skip to main content

Table 3 List of primers used for RT-(q)PCR analysis

From: Intronic tRNAs of mitochondrial origin regulate constitutive and alternative splicing

Target Primer fwd Primer rev
eGFP mRNA TGAGGAGGCTTTTTTGGAGG TTCACTAATCGAATGGATCTGTC
eGFP pre-mRNA GTAATACGACTCACTATAGGGC CATCAATATCCCAAGGAGCATG
Beta-Actin CGTCACCAACTGGGACGACA CTTCTCGCGGTTGGCCTTGG
DsredExpress2 GTCCTTCCCCGAGGGC TTCAGCACGCCGTCGCG
GAPDH CCATGGGGAAGGTGAAGGTC AGTTAAAAGCAGCCCTGGTGA
Alt. spl. Rep. AGTGATTCAGAACCGTCAAG TCCACCACCGTCTTCTTTAG
PPFIBP1 incl ex 29 ccaaagtgaagCCAAAGAAACTT aatcttccatctgctctaaccg
PPFIBP1 excl ex 29 gttctagagcctcgttttaacg tgaatcttccatcttcactttgg
PPFIBP1 upstream gaaacagaaaaagagacagcaga CTTCTCCTAAGTtttccaaagagt