Skip to main content

Table 1 List of primers used for classical cloning in this study.

From: Intronic tRNAs of mitochondrial origin regulate constitutive and alternative splicing

Plasmid Primer fwd Primer rev Entry plasmid
Y GGGGTACCCCGTTCCG ATATCTTTGTGATTG GGAATTCCATATGGAA TTCCCACCTTAAGACCT CTGGTA Low0-eGFP
YC GGGGTACCCCGTTCCG ATATCTTTGTGATTG GGAATTCCATATGGAA TTCCTCTACTTCTACCG CCGAAA Low0-eGFP
YCN GGGGTACCCCGTTCCG ATATCTTTGTGATTG GGAATTCCATATGGAATTCCAGACCTCAACTAGATTGGC Low0-eGFP
YCNA GGGGTACCCCGTTCCG ATATCTTTGTGATTG GGAATTCCATATGGAATTCCAACTTCTGATAAGGACTGTAG Low0-eGFP
(nucl.) YCNAW GGGGTACCCCGTTCCG ATATCTTTGTGATTG GGAATTCCATATGGAATTCCGCTGTCATAAGTACAATAACC Low0-eGFP/Low2-eGFP
C GGGGTACCCCTTTTTACCAGAGGTCTTAAGG GGAATTCCATATGGAA TTCCTCTACTTCTACCG CCGAAA Low0-eGFP
N GGGGTACCCCCTACCGCCATTTTTTTTTTCG GGAATTCCATATGGAA TTCCAGACCTCAACTAG A TTGGC Low0-eGFP
A GGGGTACCCCGCCAATCTAGTTGAGGTCT GGAATTCCATATGGAATTCCAACTTCTGATAAGGACTGTAG Low0-eGFP
W GGGGTACCCCCTACAGTCCTTATCAGAAGTT GGAATTCCATATGGAATTCCGCTGTCATAAGTACAATAACC Low0-eGFP