Skip to main content

Table 1 Primers used for quantitative PCR

From: A human lung tumor microenvironment interactome identifies clinically relevant cell-type cross-talk

GenePrimers
GAPDHGAPDH-hFw 5′-GAAGGCTGGGGCTCATTT -3′
GAPDH-hRv 5′-GGAGGCATTGCTGATGATCT -3′
Gremlin-1GREM-hFw 5′-ACTCTCGGTCCCGCTGAC -3′
GREM-hRv 5′- GCTGTGCGGCTCATACTGTC -3′
p21p21-hFw 5′- CAGGCGCCATGTCAGAAC -3′
p21-hRv 5′- GCTCAGCTGCTCGCTGTC -3′
c-Mycc-Myc -hFw 5′- TACAACACCCGAGCAAGGAC -3′
c-Myc -hRv 5′- GAGGCTGCTGGTTTTCCACT -3′