Skip to main content

Table 3 List of siRNAs used for SOX9 and SOX10 knockdown

From: Multiple-gene targeting and mismatch tolerance can confound analysis of genome-wide pooled CRISPR screens

siRNA Vendor Cat# Sense Antisense
SOX9-1 Ambion s13306 AGACCUUCGAUGUCAACGATT UCGUUGACAUCGAAGGUCUCG
SOX9-2 Ambion s532658 CCUUCGAUGUCAACGAGUUTT AACUCGUUGACAUCGAAGGTC
SOX9-3 Ambion s532659 CCCGCUCACAGUACGACUATT UAGUCGUACUGUGAGCGGGTG
SOX10-1 Ambion s13309 CCACCUCACAGAUCGCCUATT UAGGCGAUCUGUGAGGUGGAT
SOX10-2 Ambion s13310 CCGUAUGCAGCACAAGAAATT UUUCUUGUGCUGCAUACGGAG
SOX10-3 Ambion s13311 GCAACGUGGACAUUGGUGATT UCACCAAUGUCCACGUUGCCG
Silencer Select Negative Control #2 Ambion 4390846   
AllStars Hs Cell Death Control Qiagen SI04381048