Skip to main content

Table 1 Primers used in study.

From: Phytophthora capsici-tomato interaction features dramatic shifts in gene expression associated with a hemi-biotrophic lifestyle

Primer Direction Sequence
PcTubulin Forward GACTCGGTGCTTGATGTTGTC
  Reverse CCATCTCATCCATACCCTCGCCAG
PcHmp1-F Forward CATGATGGCAGTCATGGTCGGTGAAG
PcHmp1-R Reverse TTAGCTAACATTGAGGCGGGCATGCAG
PcNPP1-F: Forward CAGCTCCACATCACCAACGGct
PcNPP1-R Reverse CTCTTCCCGTTCAAATAGTTC
PcCDC14-F Forward GGAAGCGATTGAGTTCTTGC
PcCDC14-R Reverse TTCTCCACACGCTCAAAGTG