Skip to main content

Advertisement

Table 3 Primer sequences

From: Draft genome of the mountain pine beetle, Dendroctonus ponderosae Hopkins, a major forest pest

Name Direction Sequence
hypo Forward GGTGCTGCCTTTTCTTTGCTATTT
scrB Reverse CCCAATAACCACATACCAAGACC
scrB (internal) Forward CCAACATGGCTGGATGAATGACCC
  Reverse CCTGAGCGCCTCCGTCTCTTTC