Skip to main content

Table 1 Primer and probe sequences

From: Simultaneous transcription of duplicated var2csa gene copies in individual Plasmodium falciparum parasites

Target gene (application) Primers Probes
seryl-tRNA synthesase (real-time PCR) F: TATCATCTCAACAGGTATCTACATCTCCTA NA
  R: TTTGAGAGTTACATGTGGTATCATCTTTT  
β-tubulin (real-time PCR) F: CGTGCTGGCCCCTTTG NA
  R: TCCTGCACCTGTTTGACCAA  
var2csa DBL2x (real-time PCR) F: AATCATGGTGGAACACGAACAA 6-FAM-ATATTTGGTTAGCAATGAA-MGB (allele 1)
  R: AACTACTACCACTACCAGTGACACTACCAT 6-VIC-ATATATTTGGACAGCAATGA-MGB (allele 2)
var2csa DBL4ε (real-time PCR) F: TATACCGTAAAAGTAACAAAGAATCGGAA 6-FAM-ATGATTATGGAACCTACAGTC-MGB (allele 1)
  R: ACAACTACAACAAATGTAGTTCCCATTAATT 6-VIC-ATGATTATGGCACCTACAGT-MGB (allele 2)
Pf332 S326P (real-time PCR) F: AGTGGTTCCCAAGAAGAAGAACAA 6-FAM-ATGATGTGTCACATAGGA-MGB (wild type)
  R: ACATTCTGTCATCTAATTTATCCAGTAGAGAT 6-VIC-ATGTGCCACATAGGA-MGB (Mutant)
var2csa nest 1 (single cell PCR) F: ACTTGAAAATGTGTGCAAAGGAGTA NA
  R: TTACCCAGTGGAGACGGAACAT  
var2csa lr1 (DNA-FISH/Southern blot) F: AAAATTACTGTGAATCATTCAGAT NA
  R: AAGGTGTTTCAGACGAAGTATTAGCAT  
var2csa lr2 (DNA-FISH) F: ACTGTGAATGTTACGAATTGTGGATAA NA
  R: ACATTTCCCCCTCAATTCCTTT  
var2csa PFHG_05046.1_Sp6_a (RNA-FISH, detecting mRNA) F: TCATTTAGGTGACACTATAGAAGTGTATATTTT
GGGTCATCATTTCGATATTT
NA
  R: GAGATGAAAACAAGTGTGAAACAAAATC  
var2csa PFHG_05046.1_Sp6_s (RNA-FISH, detecting antisense) F: TCATTTAGGTGACACTATAGAAGAGATGAAAA
CAAGTGTGAAACAAAATCC
NA
  R: TGTATATTTTGGGTCATCATTTCGAT  
var2csa PFHG_05155.1_Sp6_a (RNA-FISH, detecting mRNA) F: TCATTTAGGTGACACTATAGAAGTGCTTATAA
TTTTCATCATCATTTGGATATTTATC
NA
  R: CAGATCAATTGAAAGGTTCTAACATTTT  
var2csa PFHG_05155.1_Sp6_s (RNA-FISH, detecting antisense) F: TCATTTAGGTGACACTATAGAAGAGATCAATT
GAAAGGTTCTAACATTTTAGAAC
NA
  R: CTTATAATTTTCATCATCATTTGGATATTTATC  
kahrp_Sp6_a (RNA-FISH, detecting mRNA) F: TCATTTAGGTGACACTATAGAAGAGGTTGGTG
AACCTGTGGTGCTT
NA
  R: AACTTTAGCACAAAAGCAACATGAA  
kahrp_Sp6_s (RNA-FISH, detecting antisense) F: TCATTTAGGTGACACTATAGAAGAGAACTTTA
GCACAAAAGCAACATGAA
NA
  R: GTTGGTGAACCTGTGGTGCTT  
  1. F, forward; NA, not applicable; R, reverse.