Skip to main content

Table 3 Splice-leader isoforms isolated in two chætognath species: S. cephaloptera and F. enflata

From: Chætognath transcriptome reveals ancestral and unique features among bilaterians

Form ID Sequence Species Abundance
Form 1 SL1 GGAAGCTAAAATTCTTTTA--TTTGCTT-AATTAAA Both <
Form 2 SL2.0 GGAAGCTTATAATTGAGTAGTTTCAATTTGTTTAAA Both 70.83%
  SL2.1 GGAAGCTTATAATTGAGTGGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.2 GGAAGCTTATAATTGAGCAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.3 GGAAGCTTATAATTGACTATTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.4 GGAAGCTTATAATTGAGTATTTTCAATTTGTTTAAA S. cephaloptera 1.44%
  SL2.5 GGAAGCTTATAATTGCGTATTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.6 GGAAGCTTATAATTGCGTAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.7 GGAAGCTTATAATTCATTAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.8 GGAAGCTTATAATTCAGTAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.9 GGAAGCTTATAATTGATTAGTTTCAATTTGTTTAAA S. cephaloptera 2.17%
  SL2.10 GGAAGCTTATAACTGTTTAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.11 GGAAGCTTATAATTGACTAGTTTCAATTTGTTTAAA S. cephaloptera <
  SL2.12 GGAAGCTTATAATTGAGTAGCTTCAATTTGTTTAAA S. cephaloptera <
Form 3 SL3.1 GGAAGCCAAT-TTCTACTA-CTTCACTT-GTTTAAA F. enflata -
  SL3.2 GGAAGCTAAT-TTCTACTA-CTTCACTT-GTTTAAA F. enflata -
  SL3.3 GGAAGCTAAT-ATCTACTA-CTTCACTTTGTTTAAA F. enflata -
Form 4 SL4.1 GGAAGCTTATTATCAAGTACTACCAATTTGTTTAAA S. cephaloptera <
  SL4.2 GGAAGCTTATTATTAAGTACTACCAATTTGTTTAAA S. cephaloptera 16.91%
  SL4.3 GGAAGCTTATTATTAAGTACTACCAAATTGTTTAAA S. cephaloptera <
  SL4.4 GGAAGCTTATTATTAAGTACTACCAGTTTGTTTAAA S. cephaloptera <
  SL4.5 GGAAGCTTATTATTACGTACTACCAATTTGTTTAAA S. cephaloptera <
  SL4.6 GGAAGCTTATTATTAATTACTACCAATTTGTTTAAA S. cephaloptera <
  SL4.7 GGAAGCTTATTATTATTTACTACCAATTTGTTTAAA S. cephaloptera <
  SL4.8 GGAAGCTTATTATTAACTACTACCAATTTGTTTAAA S. cephaloptera <
  SL4.9 GGAAGCTTATTATTCAGTACTACCAATTTGTTTAAA S. cephaloptera <
  1. The abundance of the forms corresponds to the rate of the forms among all SLs and is calculated only for S. cephaloptera sequences. A 'less-than' sign indicates that the abundance is below 1%.