Skip to main content

Table 3 Primer sequences

From: The impact of chromatin modifiers on the timing of locus replication in mouse embryonic stem cells

Replication timing/ChIP    
Locus Forward Reverse Tann
   Gbe GGTGCAGATCATCCCCTTGA TTACCCGACGGCGAAAG 60
   α-Globin CCACAAGCTGCGTGTGGAT ATGCCGCCTGCCAGGT 60
   Oct4 GGGTGAGAAGGCGAAGTCTGAA GTGAGCCGTCTTTCCACCAGG 55
   Nanog CCCTCTGAGTTTGACCGGTGA CAAGCTAGGATGTTAGGTCTCCCTG 60
   Esg1 AAAGACGAACACAGAGTCAAACACC CACCTGCTCGATGTGAGACATTC 60
   Zfp57 TGCAAGATAAGAACGAGGAGCAGGAG CCTTTGCGGCTTTGTGGATTTGTG 60
   Rex1 TTTGCGGGAATCCAGCAGT CGTCCCATCGCCACTCTAGAC 55
   Sox2 CCATCCACCCTTATGTATCCAAG CGAAGGAAGTGGGTAAACAGCAC 55
   Nkx2.9 AAGTGCGAGGCGCTCG TGGCACCTTCCGGACTTG 60
   Sox3 TGCCCAGATGGCTTCCTATT ACCCGGACATTCTCCGCT 60
   Mage a2 TTGGTGGACAGGGAAGCTAGGGGA CGCTCCAGAACAAAATGGCGCAGA 60
   Ebf AGATCTGGTTGAAGCCCTGTATGG CATGTCACATCTCAGATCCTGTGTTCT 60
   Mash1 CCAGGCTGGAGCAAGGGA CGGTTGGCTTCGGGAGC 55
   β-Globin GGTGAACTTTACTGCTGAGGAAAAG TCACCACCAACCTCTTCAACAT 60
   Myf5 GGAGATCCGTGCGTTAAGAATCC CGGTAGCAAGACATTAAAGTTCCGTA 55
   Math1 CCCTCACTCAGGTCGCCTG CGTGCGAGGAGCCAATCA 55
   Sox1 ACAAGAGGAGGCAGCGAACC TCGCAGGTGGAAAGTTTCTCC 55
   Msx1 ACAGAAAGAAATAGCACAGACCATAAGA TTCTACCAAGTTCCAGAGGGACTTT 55
   Frg1 AAGGAGCCTATATCCATGCACTGGAC GCCTCCCTGCCATTGCTTGT 60
   Slc7a2 GACAAGGAACAGGGCGAGAAG CTTTCCTCATCCTGGGCTTGAGTA 60
   Msr1 GCCACCAATGCCCTAGAATTTC GGCAGGCTCTCACTAGGAAGC 60
   Loc2 ACTAGCAACTGGACATAAGAGTACACTACC ATTACATATGGTGTCTGGAAGCCAG 60
   Adam 26 CCTTGAACAACGCCCTTTTGTG GCAAGCTCCCAAAACAGGTGT 60
   Loc4 TAAGGTAGGCAGTGAGAGACATCCA GGTGTAAGAAGGTTAGAACTAA 60
   X141 GGGTCATAAAACGCTTTTCCAGGAA TAGCACTGGAGATCAGATTGACGCCT 60
   Minor satellite TGATATACACTGTTCTACAAATCCCGTTTC ATCAATGAGTTACAATGAGAAACATGGAAA 55
   Major satellite GACGACTTGAAAAATGACGAAATC CATATTCCAGGTCCTTCAGTGTGC 55
   rDNA CCTGTGAATTCTCTGAACTC CCTAAACTGCTGACAGGGTG 60
   IAP TTGATAGTTGTGTTTTAAGTGGTAAATAAA AAAACACCACAAACCAAAATCTTCTAC 60
   LINE 1 TTTGGGACACAATGAAAGCA CTGCCGTCTACTCCTCTTGG 60
   SINE B1 GTGGCGCACGCCTTTAATC GACAGGGTTTCTCTGTGTAG 60
Gene expression    
   Mage a2 GAAGATCTCAGGAGTGTCAGGACTG TCAGCCATTATGACTGTCCTAGGTAA 60
   Ubc AGGAGGCTGATGAAGAGCTTGA TGGTTTGAATGGATACTCTGCTGGA 60
   Oct4 CCCAAGGTGATCCTCTTCTGCTT GAGAAGGTGGAACCAACTCCCG 60
CpG methylation assay    
   Major sat GACGACTTGAAAAATGACGAAATC CATATTCCAGGTCCTTCAGTGTGC 55
   Sox2 TGGACTGCGAACTGGAGAAGG CGCCCGGAGTCTAGCTCTAAATATT 60
  1. IAP, intracisternal A particle. Tann, annealing temperature.