Skip to main content

Table 1 Primers used for determination of mRNA expression levels by Q-RT-PCR

From: Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity

Gene Forward primer Reverse primer
Mouse   
Gapdh TGCACCACCAACTGCTTAG GATGCAGGGATGATGTTC
Oct4 (Pou5f1) CCAATCAGCTTGGGCTAGAG CCTGGGAAAGGTGTCCTGTA
Pecam GTCATGGCCATGGTCGAGTA CTCCTCGGCGATCTTGCTGAA
Lyve-1 AGGAGCCCTCTCCTTACTGC ACCTGGAAGCCTGTCTCTGA
vWF GCCAAAGATCTGGAACAGTGT GATGGAGAGGTTACACATCTC
F2 CAGCTATGAGGAGGCCTTTG TCACACCCAGATCCATAGCA
Tat TTAAGTCCAATGCGGACCTC GCTCTGTGAATTCCACGTCA
Afp GCCCTACAGACCATGAAACAAG GTGAAACAGACTTCCTGGTCCT
Ttr CTTTGCCTCTGGGAAGACC CAGAGTCGTTGGCTGTGAAA
Foxa2 CCCGGGACTTAACTGTAACG TCATGTTGCTCACGGAAGAG
Hnf4a GGTCAAGCTACGAGGACAGC ATGTACTTGGCCCACTCGAC
Sox7 CTTCAGGGGACAAGAGTTCG CCATGACTTTCCCAGCATCT
Sox17 CACAACGCAGAGCTAAGCAA TTGTAGTTGGGGTGGTCCTG
Myocd CTGTGTGGAGTCCTCAGGTCAAACC GATGTGTTGCGGGCTCTTCAG
Pdgra ACGTTCAAGACCAGCGAGTT CCTCCAGCATGGTGATACCT
Pdgfrb CACCTTCTCCAGTGTGCTGA GGAGTCCATAGGGAGGAAGC
Tek AAGCATGCCCATCTGGTTAC GCCTGCCTTCTTTCTCACAC
Fbx15 GGCCTTGAATGGAGAACTGA TCAAACCACCCTAGGTCTGC
Dnmt3l CCTGGTGAAGAACTGCCTTC GCAAAGTGAGCTGCACAGAG
Rex1 CCTGCACACAGAAGAAAGCA TCAGTCTGTCGAGGGCTCTT
Dppa5 CAGTCGCTGGTGCTGAAATA TCCATTTAGCCCGAATCTTG
Eras CCCTGCTTGTCCATGAGATT TGGTAACTTGGTCGGAGAGG
Utf1 GGCCATACCTTCGAATCCTC GGTTTGGTCGAAGGAACCTC
Tdgf1 GCATCCTACGAGGGAGTTGA CACTGTGCTTGGCTGAAGAA
Tcl1 TTCCTCTCTGGGTGTTCAGG ATCCCACACATTCCCTTTCA
Ecat1 GAATGCCTGGAAGATCCAAA AAATCTCAGCTCGCCTTTCA
Nanog GAGTGTGGGTCTTCCTGGTC GAGGCAGGTCTTCAGAGGAA
Gdf3 CGCAGGACTTATGCTACGTG CTGGGCCATGGTCAACTT
Fgf4 CCGACGAGTGTAAATTCAAAGAA GGAAGTGGGTTACCTTCATGG
Sox2 ACCAGCTCGCAGACCTACAT AGTGGGAGGAAGAGGTAACCA
Sox1 CACAACTCGGAGATCAGCAA TGTAATCCGGGTGTTCCTTC
Pax6 TCAGACCTCCTCATACTCGTGCA TGTAGGTATCATAACTCCGCCCA
Rat   
Gapdh TGCACCACCAACTGCTTAG GATGCAGGGATGATGTTC
Oct4 (Pou5f1) CTGTAACCGGCGCCAGAA TGCATGGGAGAGCCCAGA
Vecad GGCCAACGAATTGGATTCTA GTTTACTGGCACCACGTCCT
Flt-1 TGGCCAGAGGCATGGAGT TCGCAAATCTTCACCACATTG
Flk-1 CCAAGCTCAGCACACAAAAA CCAACCACTCTGGGAACTGT
vWF CCCACCGGATGGCTAGGTATT GAGGCGGATCTGTTTGAGGTT
Afp ACCTGACAGGGAAGATGGTG GCAGTGGTTGATACCGGAGT
Alb CTGGGAGTGTGCAGATATCAGAGT GAGAAGGTCACCAAGTGCTGTAGT
Tat AACCTCAGCACCAATGTTCC TCTTCAGAGCACCCTGGACT
Ttr CAGCAGTGGTGCTGTAGGAGTA GGGTAGAACTGGACACCAAATC
Sox2 AACCCCAAGATGCACAACTC CCGGGAAGCGTGTACTTATC
Otx1 GTTCGCAAAGACTCGCTACC CCGGAGACGACTTCTTCTTG
Blbp CCAGCTGGGAGAAGAGTTTG TTTCTTTGCCATCCCACTTC
Pax6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT