Skip to main content

Table 5 Primers for housekeeper genes

From: Statistical modeling for selecting housekeeper genes

  Length (bases) GC(%) *Tm (°C)
PSMC4 (UniGene reference Hs.211594 - Gene ID: 5704)    
GGCATGGACATCCAGAAG 18 55.6 60
CCACGACCCGGATGAAT 17 58.8 61
Amplified fragment 190 61 90
MRPL19 (UniGene reference Hs.44024 - Gene ID: 9801)    
GGGATTTGCATTCAGAGATCAG 22 45 62
GGAAGGGCATCTCGTAAG 18 56 61
Amplified fragment 182 44 83
PUM1 (UniGene reference Hs.153834 - Gene ID:9698)    
TGAGGTGTGCACCATGAAC 19 53 61
CAGAATGTGCTTGCCATAGG 20 50 61
Amplified fragment 187 53 87
SF3A1 (UniGene reference Hs.406277 -Gene ID:10291)    
GGAGGATTCTGCACCTTCTAA 21 47 61
GCGGTAGTAGGCATGGTAA 19 52 60
Amplified fragment 196 48 85
ACTB (UniGene reference Hs.426930 - Gene ID:60)    
TTCCTGGGCATGGAGTC 17 59 60
CAGGTCTTTGCGGATGTC 18 55 60
Amplified fragment 84 55 84
GAPD (UniGene reference Hs.169476 - Gene ID:2597)    
AACAGCCTCAAGATCATCAGC 21 48 63
GGATGATGTTCTGGAGAGCC 20 55 62
Amplified fragment 198 56 89
  1. *Primers Tm determined using Tm Utility with algorithms adapted from Santa Lucia [23]. The Tm for the amplified fragment is the empirical Tm. Primers for GAPD [20].