Skip to main content

Table 4 Primers used to construct the GFP promoter fusions

From: In silico identification and experimental validation of PmrAB targets in Salmonella typhimuriumby regulatory motif detection

Name Sequence 5' to 3' Description
Amplification of promoter regions
Pro-115 CC GAATTC TAATTCGAGTTGCTTAAAGGCGGC Amplification of yibD promoter region
Pro-116 CC GGATCC GCTCCCGCATTATATAACGGG Amplification of yibD promoter region
Pro-117 CC GAATTC GCCAATAAAAACCGCGCAGAGTG Amplification of mig-13 promoter region
Pro-118 CC GGATCC AGCGAGTTGTTAAGGTTTTCCAGC Amplification of mig-13promoter region
Pro-119 CC GAATTC GAAGATTCCGCAGAATCAACGGCC Amplification of aroQ promoter region
Pro-120 CC GGATCC GGTGCTGCACATCAATAAAGAACAAAG Amplification of aroQ promoter region
Pro-121 CC GAATTC GTATTGCATCTGGGCGGTCATCG Amplification of pmrC promoter region
Pro-122 CC GGATCC AGGCGATTTGCCCAAGAACAGG Amplification of pmrC promoter region
Pro-224 AT GAATTC GCTTCCCCATCCCAAACCACC Amplification of sseJ promoter region
Pro-225 AT GGATCC GGAAGGCGTGCGCTTTCTTTTATC Amplification of sseJ promoter region
  1. Restriction sites in the primers are indicated in bold type.