Skip to main content

Table 9 Consensus/Patser prediction in regions without binding sites reported in RegulonDB

From: Evaluation of thresholds for the detection of binding sites for regulatory proteins in Escherichia coliK12 DNA

Regulatory protein and genes thought to be regulated by it Above threshold Site coordinates and score Site sequence
ArcA (8)    
aceB + i:-164;f:-144;sc:9.48 TTCATATTGTTATCAACAAG
fadB - - -
fumA - - -
fumC + i:-74;f:-54;sc:10.82 AATAATAAGTGAGCTAAAAG
glpA - i:-184;f:-164;sc:6.11 AAGAAAACATTCATAAATTA
hyaA - - -
lpdA + i:-228;f:-208;sc:8.43 TAAAAATTGTTAACAATTTT
sucA - - -
ArgR (13)    
argD - i:-70;f:-50;sc:11.12 TAGTGATTTTTTATGCATAT
CRP (6)    
cirA + i:-51;f:-31;sc:6.39 ATGTGAGCGATAACCCATTT
dsdA - - -
ebgA + i:-91;f:-71;sc:7.53 TCGTGATCCAGTTAAAGTAA
flhD + i:-269;f:-249;sc:10.86 GTGTGATCTGCATCACGCAT
fucA + i:-399;f:-379;sc:10.18 ATATGACGGCGGTCACACTT
fucP + i:-205;f:-185;sc:9.74 AAGTGATGGTAGTCACATAA
glgC - i:-166;f:-146;sc:3.60 TCGCAATTAACGCCACGCTT
gntK + i:-169;f:-149;sc:11.49 ATTTGAAGTAGCTCACACTT
lpdA - i:-335;f:-315;sc:3.73 TGGTGATGTAAGTAAAAGAG
melA - i:-228;f:-208;sc:3.79 CTGCGAGTGGGAGCACGGTT
speC - i:-16;f:4;sc:5.55 GTTTGACCCATATCTCATGG
srlA + i:-91;f:-71;sc:8.89 TTGCGATCAAAATAACACTT
ubiG - i:-234;f:-214;sc:5.93 CAATGACCGACATCGCATAA
CysB (4)    
cysP + i:-237;f:-217;sc:7.04 TTTATTTGTCATTTTGGCCC
CytR (1)    
nupC - - -
FNR (7)    
aspA - i:-367;f:-347;sc:3.88 CATGGGCAACCTGAATAAAG
cyoA - i:-182;f:-162;sc:4.31 TTTGTTATAACGCCCTTTTG
icdA - i:-105;f:-85;sc:6.30 AATCATTAACAAAAAATTGC
sdhC - i:-4;f:16;sc:3.89 ATTCATGATAAGAAATGTGA
FruR (5)    
aceB + i:-253;f:-233;sc:11.44 GATCGTTAAGCGATTCAGCA
fruB + i:-38;f:-18;sc:13.85 GAGGCTGAATCGTTTCAATT
ppsA + i:-105;f:-85;sc:6.29 TTTGCTTGAACGATTCACCG
IHF (7)    
caiT + i:-83;f:-63;sc:8.41 AATAATAATTATATTAAATG
ecpD + i:-39;f:-19;sc:8.96 ATTATTCCCTGTTTTAATTA
himA - - -
himD - i:-136;f:-116;sc:6.43 ATTCCGAAGTTTGTTGAGTT
hycA - i:-73;f:-53;sc:6.57 TAATAACAATAAATTAAAAG
hypA - i:-155;f:-135;sc:6.75 TTAATTTATTGTTATTAAAG
narK - i:-106;f:-86;sc:6.66 AAATATCAATGATAGATAAA
ompR - i:-135;f:-115;sc:6.39 TATACTTAAGCTGCTGTTTA
sucA - - -
LexA (9)    
umuD + i:-40;f:-20;sc:10.80 CTACTGTATATAAAAACAGT
Lrp (8)    
livK + i:-235;f:-215;sc:8.35 TGCCGTTATTTTATGCTGAC
sdaA - i:-317;f:-297;sc:4.95 ATCACCCTTTAGATATCTAC
serA - i:-79;f:-59;sc:6.62 TGCCGCAATATTATTTTTTG
NarL (7)    
adhE - i:-160;f:-140;sc:6.11 ATAACTCTAATGTTTAAACT
caiF - i:-163;f:-143;sc:5.62 CAAATAATAGCGTGTCATGG
torC - i:-20;f:0;sc:4.98 ATAATTCTACAGGGGTTATT
PurR (11)    
codB + i:-84;f:-64;sc:13.10 CCACGAAAACGATTGCTTTT
prsA + i:-360;f:-340;sc:12.33 GCAAGAAAACGTTTTCGCGA
speA - i:-136;f:-116;sc:7.05 AAAAGAAACCGGTTGCGCAG
  1. Data and analysis as described in Table 8. sc, Score as obtained from Patser. The number of families used was the same for any method, but we only show families where the methods provided significant results.