Skip to main content

Table 3 Oligonucleotide primers used to amplify and sequence mouse and human Tlr4 genes

From: Phylogenetic variation and polymorphism at the Toll-like receptor 4 locus (TLR4)

Mouse   Primate
Amplification   
Exon 1 ↑ CAGTCGGTCAGCAAACGCCTTCTTC ↑GCTCGGTAAACGGTGATAG
  ↓CAAGGCAGGCTAGCAGGAAAGGGTG ↓TGAGAAGTTCTGGGCAGAAG
Exon 2 ↑ TTATTCATCTTTGGAGAGGAGTGG ↑TCTCTGGTCTAGGAGAGG
  ↓ AAGGAAGTTTAGTTAGAACCACCTTG ↓ CCAGTCCAATAATGAAATG
Exon 3 ↑ TCTCCTGCTCACACCATCATCACCTG ↑ CCAGTCCAATAATGAAATG
  ↓ CATGTGTTCCATGGGCTCTCGGTC ↓ TGACTTTCTTTGTCATGGGTTCCTTGACTG
Sequencing   
Exon 1 same as above   
Exon 2 same as above   
Exon 3 primary 1↓ ATGCCATGCCTTGTCTTC 3.1 ↑ GAGCTGGATGACTAGGATTAATATTC
  2↓TTTAAATTCTCCCAAG 3.1 ↓TCAAATTGCACAGGCCCTCTAG
  3↓CAGCTCTTCTAGACC 3.2 ↑CAATCTCTCTTTAGACCTGTCC
  4↑ TGTGAACATCAGAAATTCCT 3.2 ↓AATACTTTAGGCTGGTTGTCCC
  5↑ TGAGATTGCTCAAACATGG 3.3 ↑ GAAGTTGATCTACCAAGCCTTG
  6↑ TTGAAACAATTGAAGACAAGGC 3.3 ↓ GGAAGTCATTATGTGATTGAGAC
  7↑ CCTGGCTGGTTTACACGTC 3.4↑ CTTCCTGGACCTCTCTCAGTGTCAAC
  8↑ TTTCATGGGTCTAGAAGAGCTG 3.4↓ GAAGGCAGAGCTGAAATGGAGG
  9↓ AAGAACTGCTTCTGTTCC 3.5↑ TCAGATGAATAAGACCATCATTGGTG
  10↓ TCAGAAACTGCCATGTTTG 3.5↓ AACAAGTGTTGGACCCAG
Exon 3 secondary 5'↑ TGAGCTGGTAAAGAATTTAG 1↑ GTAAATTTGGACAGTTTCC
  7'↑ CTGACGAACCTAGTACATGTG 2↑ TTCAGTATTCCTATCACTCAG
  9'↓ ATGTCAAGTTTGTTGTGTT 3↑ TTATAAGTGTCTGAACTCCC
   4↑ TCGGTCCTCAGTGTGCTTG
   5↑ GTGTCCCAGCACTTCATC
   6↑ AACCTCCTGAGGCATTTC
   7↓ GTTTCAAATTGGAATGCTG
   8↓ AAGGAAACGTATCCAATG
   9↓ AAGCACACTGAGGACCGAC
   10↓ GATGAAGTGCTGGGACAC
   11↓ TCCTCTCTAGATAGATGTTG
   12↓ TTTCTTTGTCATGGGTTC
   0↑ TTTAGGTTCTTATTCAGCAG
   0↓ GCTCTAGATTGGTCAGATTAG
  1. ↑ Primer matches + strand; ↓primer matches - strand.