Skip to main content

Table 1 Primers used in real-time PCR

From: Pluripotent stem cell-derived models of neurological diseases reveal early transcriptional heterogeneity

Gene Forward primer Reverse primer
β-Actin 5′CCGCCGCCAGCTCAC 3′ 5′ TCACGCCCTGGTGCCT 3′
EIF4E 5′ CGTGTAGCGCACACTTTCTG 3′ 5′ ACCAGAGTGCCCATCTGTTC 3′
NSA2 5′ ACACCACAGGGAGCAGTACC 3’ 5′ TCCCTGGGCACGTACTTTAG 3’
KXD1 5′ AGGACGCTGAAAGGGAAACT 3’ 5′ TCTGTTCTGAGGTGGCAATG 3’
CHMP5 5′ CAAGACCACGGTTGATGCTA 3’ 5′ CTGCGACTCAGTGCTTCTTG 3’
EXOSC1 5′ ATAAGAGTTTCCGCCCAGGT 3’ 5′ ACTGTGGGCTACCACCACTC 3’
ADRM1 5′ GACGGACGACTCGCTTATTC 3’ 5′ ACCCGCTTGAACTCACAGTC 3’
IDH3B 5′ TGGTGATCATTCGAGAGCAG 3’ 5′ TGAGACTTGGCTCGTGTGAC 3’