Skip to main content

Table 2 List of primers used for mutagenesis PCR cloning in this study

From: Intronic tRNAs of mitochondrial origin regulate constitutive and alternative splicing

Plasmid Primer fwd Primer rev Template plasmid
Y delD GTCGAATTGCAAATTCGAAG CTTAAGACCTCTGGTAAAAAG Y
Y delT TAAGACTTCTACCGCCAT ACCTTCGAATTTGCAATTC Y
Y delAcc ttcgaaggtgtagagaaatctctacCTACCGCCATTTTTTTTTTC tttgcaattcgacatgaatatcacctTCTGGTAAAAAGGGGTAC Y
Y delAnti AGGTGTAGAGAAATCTCTAC CATGAATATCACCTTAAGAC Y
Y scrbl agtatttgcggattaacaatgactggtaccactGAGGTCTTAAGGTGGGAATTC agcattaaggctttaacactcttggttttattaaTATGTTCATTAATCGTTGATTATTCTC Y
Y r.-c. tttacagtctaatgcttactcagccattttaccGAGGTCTTAAGGTGGGAATTC tctaaacacagaggtttaaatcctctttttaccaTATGTTCATTAATCGTTGATTATTCTC Y
C r.-c. tttgcaattcgacatgaatatcaccttaagaccCTACCGCCATTTTTTTTTTC ttcgaaggtgtagagaaatctctactaagacttTCTGGTAAAAAGGGGTAC C
mt T TAAACCGGAGATGAAAACCTTTTTCCAAGGACAGAGGTCTTAAGGTGGGAATTC CAAGACTGGTGTATTAGTTTATACTACAAGGACTATGTTCATTAATCGTTGATTATTCTC Y
Y25 ctaaacacagaggtttaaatcctctttttaccaCAGTGGCAATGAGAGTGAAG atttacagtctaatgcttactcagccattttaccTCTTCGGAGAGCTTAAGG Low0-eGFP
Y50 ctaaacacagaggtttaaatcctctttttaccaGTATCAGCACTTGTGGAG atttacagtctaatgcttactcagccattttaccTTCTCCTTCACTCTCATTG Low0-eGFP
Y100 ctaaacacagaggtttaaatcctctttttaccaGGATATTGATGATCTGTAGTGCTACAG atttacagtctaatgcttactcagccattttaccCAAGGAGCATGGTGCCCC Low0-eGFP
Y214 ctaaacacagaggtttaaatcctctttttaccaCAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAAC atttacagtctaatgcttactcagccattttaccTGGGTTGGGGTCTGTGGG Low0-eGFP
Y657 ctaaacacagaggtttaaatcctctttttaccaGAGCCAATTCCCATACATTATTG atttacagtctaatgcttactcagccattttaccAAAGGATACCTTTGGACAG Low0-eGFP
Y1100 ctaaacacagaggtttaaatcctctttttaccaAATAATCTTTAAGCAATCCTC atttacagtctaatgcttactcagccattttaccGTTTTATTATTTCCAAATTGTTCTC Low0-eGFP
Y1450 ctaaacacagaggtttaaatcctctttttaccaTGAGGGACAATTGGAGAAGTG atttacagtctaatgcttactcagccattttaccTATCGCCTCCTCCAGGTC Low0-eGFP
Y2125 ctaaacacagaggtttaaatcctctttttaccaTATTCACCATTATCGTTTCAG atttacagtctaatgcttactcagccattttaccTCCCTGCCTAACTCTATTC Low0-eGFP
Y2150 ctaaacacagaggtttaaatcctctttttaccaCGTTTCAGACCCACCTCC atttacagtctaatgcttactcagccattttaccATAATGGTGAATATCCCTGCC Low0-eGFP
i1-Y ctaaacacagaggtttaaatcctctttttaccaAGTTTCCCAAAATTTTATTTTTGG atttacagtctaatgcttactcagccattttaccAAAACAGGCTTCCAACAATG Designer exon
i2–5′-Y ctaaacacagaggtttaaatcctctttttaccaAACTATAAGGTAGACATTCTTATTC atttacagtctaatgcttactcagccattttaccAGCTATTAAAAATATTGTTAATGATTC Designer exon
i2-c-Y ctaaacacagaggtttaaatcctctttttaccaTCATTTTCATTTCCAGGG atttacagtctaatgcttactcagccattttaccTAACTGTGCTCAAATTCTAG Designer exon
i2–3′-Y ctaaacacagaggtttaaatcctctttttaccaCTGTGCACACGAGTGTAG atttacagtctaatgcttactcagccattttaccCAAGAAAGAGAGATAACTGGG Designer exon
mt Ser2 hs cccccatgtctaacaacatggctttctcaAGTTTCCCAAAATTTTATTTTTGG catgagttagcagttcttgtgagctttctcAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–12 catatattaatataacaatatggctttatcaAGTTTCCCAAAATTTTATTTTTGG ggggcattattagcagttatcgcatactttctAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–32 ccttttgtgtatcatccataacttttctaAGTTTCCCAAAATTTTATTTTTGG aaaagaatgagcagttttttgttttgtttAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–34 gggggtggcagtctctttcatcAGTTTCCCAAAATTTTATTTTTGG atgttaaaaacatggcttcatcAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–55 cccccagaaaccaaactggctctcttgAGTTTCCCAAAATTTTATTTTTGG tcgtggggttaggtcctcatgcttctctAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–56 tgtcaaatgtattagtttattctttcAGTTTCCCAAAATTTTATTTTTGG tcaaaatttaaaacttttgctctttcAAAACAGGCTTCCAACAATG Designer exon
nimtRNA Ser2–67 ttaacaagaaaggctttttcaAGTTTCCCAAAATTTTATTTTTGG tcaaagtaggcttttctttttAAAACAGGCTTCCAACAATG Designer exon