Fig. 2

Monitoring the kinetics of DNA synthesis reveals structure-dependent transient and persistent stalling events. Distribution and density plots of the computed stall scores associated to the a G4- and b hairpin-forming control sequences and c all STR permutations at different time points showing time-dependent DNA polymerase stalling at DNA structures. d Example of time-dependent variation of stall scores associated to a G4 (GGGGACAGGGGGGACGGGGCTTGAAATGGGG, blue points) or a hairpin (TACGGTATAATTAAGGACGTATTTTTACGTCCTTAATTATACCGTA, red points) structure. The kinetic constants associated with DNA synthesis (λ) together with their associated coefficients of determination (R²) were extracted by fitting the experimental data using either an exponential growth or decay functions. Error bars represent the standard deviation from two independent replicates. e A similar analysis performed on two representative STRs, the GTGGGT and AAGTTT sequences repeated 8 times, highlighting transient or persistent stalling at STRs. f Distribution of the kinetic constants of DNA synthesis associated with the control sequences, e.g. random sequences of varying GC content (control), hairpins, i-motifs and G4s, and all STR permutations. λ values associated with the hairpins, i-motifs and G4s are for structured sequences that have a stall score statistically higher than the random control sequences at each time point. Centre lines denote medians, boxes span the interquartile range and whiskers extend beyond the box limits by 1.5 times the interquartile range. P values for the comparison of the distributions were calculated using Kolmogorov–Smirnov tests, ***P < 0.001