Skip to main content

Table 4 Oligonucleotides for shCDK1

From: Analysis of endothelial-to-haematopoietic transition at the single cell level identifies cell cycle regulation as a driver of differentiation

Oligo Sequence
Top GATCCCGCTGTACTTCGTCTTCTAATTCTCGAGAATTAGAAGACGAAGTACAGCTTTTTTG
Bottom TCGACAAAAAAGCTGTACTTCGTCTTCTAATTCTCGAGAATTAGAAGACGAAGTACAGCGG