Skip to main content

Table 2 Primers used for qPCR

From: Analysis of endothelial-to-haematopoietic transition at the single cell level identifies cell cycle regulation as a driver of differentiation

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
CDH5 TGGCCAGCTGGTCCTGCAGAT TGCCCGTGCGACTTGGCATC
CDK1 GGAAGGGGTTCCTAGTACTGC AAGCACATCCTGAAGACTGACT
CDK2 CTCCAGGGCCTAGCTTTCTG CCGGCGAGTCACCTCATGG
CDK4 TGAGGGGGCCTCTCTAGCTT CAAGGGAGACCCTCACGCC
CDK6 ACAGAGCACCCGAAGTCTTG GGGAGTCCAATCACGTCCAA
CDKN1A/p21 GGCAGACCAGCATGACAGAT GATGTAGAGCGGGCCTTTGA
CDKN1B/p27 TAATTGGGGCTCCGGCTAAC GAAGAATCGTCGGTTGCAGGT
CDKN1c/p57 GCTGCGGTGAGCCAATTTAG AACAAAACCGAACGCTGCTC
CYCLIN B1 CGCCTGAGCCTATTTTGGTTG AGTGACTTCCCGACCCAGTA
CYCLIN D1 GCTGTGCATCTACACCGACA AAATGAACTTCACATCTGTGGCA
CYCLIN D2 GCCACCGACTTTAAGTTTGC CGGTACTGCTGCAGGCTATT
CYCLIN D3 TGTGCTACAGATTATACCTTTGCC GCTTCGATCTGCTCCTGACA
CYCLIN E1 GACGGGGAGCTCAAAACTGA TCGGGCTTTGTCCAGCAAAT
GATA1 CTACACCAGGTGAACCGGC CTTTTCCAGATGCCTTGCGG
GATA2 CTGTTCAGAAGGCCGGGAG AATTTGCACAACAGGTGCCG
GFI1 ATCCACACTGGTGAGAAGCC GCTGCCCTCTGTAGTGTTGT
LMO2 CAGAACATTGGGGACCGCTA GTCTTGCCCAAAAAGCCTGA
KLF1 CCGAGGAAGAGGAGGCTTGAG GGAAGTCATCCTGTGTGTCCG
MEIS1 GCGCAAAGGTACGACGATCT GGTACTGATGCGAGTGCAGA
MYB GCTACTGCCTGGACGAACTG GTTGTTAACAGTGGGCTGGC
PECAM1 CAGGCGCCGGGAGAAGTGAC CGTCCAGTCCGGCAGGCTCT
RB1 CTGTGGATGGAGTATTGGGAGG TCTCATCTAGGTCAACTGCTGC
RBL1/p107 AGCAGAGGAGGATTCCTTGCAG GGGCACATAATCGCATTGGC
RBL2/p130 GCTACACGCTGGAGGGAAAT TCCTTCCACTGTCCCTTTGC
RPLP0 GGCGTCCTCGTGGAAGTGAC GCCTTGCGCATCATGGTGTT
RUNX1 CATCGCTTTCAAGGTGGTGG CATGGCTGCGGTAGCATTTC
SPI1 CCCCACGACCGTCCAG GTAATGGTCGCTATGGCTCTCC
TAL1 TACTGATGGTCCCCACACCA CCAGGCGGAGGATCTCATTC
VWF TTACGTGGGTGGGAACATGG TCTGTGGTGACTGTGCCATC