Skip to main content

Table 1 QPCR primers for gene expression analysis

From: Whole genome DNA sequencing provides an atlas of somatic mutagenesis in healthy human cells and identifies a tumor-prone cell type

 ForwardReverse
ACTA2acaggaatacgatgaagccggctttggctaggaatgatttgg
AQP1ggaccggcagagctctacagacgtcttctggacccatgct
CALB1ttacctggaaggaaaggagctgcatcttctgtgggtaatacgtgagcc
COL1A1atgaccgagacgtgtggaaatttcttggtcggtgggtgact
CUBNtgtttcttacggggtctgctcagcagaccaattgcactcccttt
KIM1 (HAVCR1)cgtgggtggttcaatgacatgatgacggttggaacagttgtgac
LPR2ccaaagactgttcagatgacgcctgagccatcatcacagtcttg
Nephrin (NPHS1)cacacggtcagcacaacagagggaaacctcgggaataagacacct
PAX2caaagttcagcagcctttcctcaccattggagcgaggaat
PAX8atccggcctggagtgataggtggcgtttgtagtccccaatc
PDZK1ccctgtgatgaatggaggtgttcatagccacaccttgaggtgt
PECAM1ttcaagccttgagggtcaagtgtaaaacagcacgtcatcctt
Podocin (NPHS2)taccaaatcctccggcttaggtttggctcttccaggaagcaga
SLC5A12ttgtgggcttcttaacggttccgcctgagaggatctacatca
SLC9A3ttgaggaggtccatgtcaacggcgccacgaaagattcaaaca
SLC17A3aagaacgcacaagatatgcaagttgtaagacgagggctattccat
SLC22A7actttcttcttcgccggtgtattacatagctgacggaggctg
UMODactacgtctacaacctgacagctctatactgcactcctcacacg
VCAM1/CD106cagtaaggcaggctgtaaaagatggagctggtagaccctcg