Skip to main content

Table 1 Twenty-five miRNAs analyzed in the RNA-seq experiments

From: Prediction of functional microRNA targets by integrative modeling of microRNA binding and target expression data

miRNA name miRNA sequence Identified targets
hsa-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU 31
hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA 35
hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG 32
hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC 151
hsa-miR-126-3p UCGUACCGUGAGUAAUAAUGCG 11
hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 48
hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA 108
hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA 108
hsa-miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU 82
hsa-miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 42
hsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGU 154
hsa-miR-15a-5p UAGCAGCACAUAAUGGUUUGUG 108
hsa-miR-16-5p UAGCAGCACGUAAAUAUUGGCG 122
hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 74
hsa-miR-193b-3p AACUGGCCCUCAAAGUCCCGCU 102
hsa-miR-200a-3p UAACACUGUCUGGUAACGAUGU 35
hsa-miR-200b-3p UAAUACUGCCUGGUAAUGAUGA 126
hsa-miR-200c-3p UAAUACUGCCGGGUAAUGAUGGA 93
hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG 206
hsa-miR-210-3p CUGUGCGUGUGACAGCGGCUGA 43
hsa-miR-21-5p UAGCUUAUCAGACUGAUGUUGA 11
hsa-miR-31-5p AGGCAAGAUGCUGGCAUAGCU 85
hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 155
hsa-miR-9-3p AUAAAGCUAGAUAACCGAAAGU 182
hsa-miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA 106