Skip to main content

Table 1 Genomic alignments for guides targeting SOX9 and SOX10 in the Avana library

From: Multiple-gene targeting and mismatch tolerance can confound analysis of genome-wide pooled CRISPR screens

  Type On-target Off-target Spacer sequence BaseSub Chr Pos
Guide A1 PM SOX9   GCTCGGACACCGAGAACACG   17 72,121,509
Guide A2 PM SOX9   GCAGCACAAGAAGGACCACC   17 72,122,775
  MM   SOX10 GCAGCACAAGAA-GACCACC GA 22 37,978,058
Guide A3 PM SOX9   GCACCTGGCTGACCGCCTCG   17 72,121,612
  MM   SOX10 GCACCTGGCTGAC-GCCTCG CG 22 37,983,546
Guide A4 PM SOX9   GCTGGTACTTGTAATCCGGG   17 72,122,793
  MM   SOX10 GCTGGTACTTGTA-TCCGGG AG 22 37,978,040
Guide B1 PM SOX10   ACAAGTACCAGCCCAGGCGG   22 37,978,032
Guide B2 PM SOX10   GTAGTGGGCCTGGATGGCGG   22 37,977,942
Guide B3 PM SOX10   GCACCTGGCTGACGGCCTCG   22 37,983,546
  MM   SOX9 GCACCTGGCTGAC-GCCTCG GC 17 72,121,612
Guide B4 PM SOX10   GCTGGTACTTGTAGTCCGGG   22 37,978,040
  MM   SOX9 GCTGGTACTTGTA-TCCGGG GA 17 72,122,793
  MM   SOX8 GCTGGTACTTGTAGTC-GGG CG 16 983,802
  1. PM perfect match alignment, MM single-mismatch alignment, BaseSub base substitution in the protospacer sequence