Fig. 7
From: DeepCRISPR: optimized CRISPR guide RNA design by deep learning

A Circos plot example visualizing the off-target profile of a given sgRNA (GCCTCTTTCCCACCCACCTTGGG) in the HEK293t cell type
From: DeepCRISPR: optimized CRISPR guide RNA design by deep learning
A Circos plot example visualizing the off-target profile of a given sgRNA (GCCTCTTTCCCACCCACCTTGGG) in the HEK293t cell type