Skip to main content

Table 1 Primers/oligos used in this study

From: Genome-wide analyses reveal a role of Polycomb in promoting hypomethylation of DNA methylation valleys

Tet1 sgRNA-F CACCggctgctgtcagggagctca
Tet1 sgRNA-R AAACtgagctccctgacagcagcc
Tet2 sgRNA-F CACCgaaagtgccaacagatatcc
Tet2 sgRNA-R AAACggatatctgttggcactttc
Tet3 sgRNA-F CACCgagtgccccgacttcctcgag
Tet3 sgRNA-R AAACctcgaggaagtcggggcactc
Eed sgRNA 1-F CACCgaggtgctgccgccttgtttt
Eed sgRNA 1-R AAACaaaacaaggcggcagcacctc
Eed sgRNA 2-F CACCgctacttttgaattcacatc
Eed sgRNA 2-R AAACgatgtgaattcaaaagtagc
4C bait in DMV Pax6-F without adapters tcagtgggagaggccactgg
4C bait in DMV Pax6-R without adapters ccccacagtccatctctcag
4C bait in DMV Pax6-F with adapters Aatgatacggcgaccaccgagatctacactctttccctacacgacg ctcttccgatcttcagtgggagaggccactgg
4C bait in DMV Pax6-R with adapters Caagcagaagacggcatacgagatcaggatgtgactggagttcag acgtgtgctcttccg
4C bait out of DMV Pax6-F without adapters aacagacattctttgccact
4C bait out of DMV Pax6-R without adapters acatttggaggccacagatc
4C bait out of DMV Pax6-F with adapters aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctaacagacattctttgccact
4C bait out of DMV Pax6-R with adapters caagcagaagacggcatacgagattgtggcgtgactggagttcagacgtgtgctcttccg
4C bait in DMV Nkx2-2-F without adapters tccacgcagaattctttagt
4C bait in DMV Nkx2-2-R without adapters tatctccagctgtgcctgt
4C bait in DMV Nkx2-2-F with adapters aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatcttccacgcagaattctttagt
4C bait in DMV Nkx2-2-R with adapters caagcagaagacggcatacgagattacgacgtgactggagttcagacgtgtgctcttccg
4C bait out of DMV Nkx2-2-F without adapters gcctaggcactggaaaactg
4C bait out of DMV Nkx2-2-R without adapters agaccaggactcacaccaca
4C bait out of DMV Nkx2-2-F with adapters aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctgcctaggcactggaaaactg
4C bait out of DMV Nkx2-2-R with adapters caagcagaagacggcatacgagatacagacgtgactggagttcagacgtgtgctcttcc