Skip to main content

Table 1 Gene and primer details used for quantitative PCR

From: A depauperate immune repertoire precedes evolution of sociality in bees

Gene Putative gene function NCBI accession Forward primer Reverse primer Product size (base pairs)
AK Arginine kinase, housekeeping AF_492888 CTGGACTCTGGTGTCGGTAT GTCTTTTGGTGGATGCTTGT 129
PLA2 Phospholipase A2, housekeeping FN_391388 TATCTTTCAATGCCCAGGAG GTCGTAACAAATGTCATGCG 129
ef1α Elongation factor 1α XM_003401944 GCTGGTGACTCGAAGAACAATC GGGTGGTTCAACACAATAACCTG 74
BGRP1 Recognition receptor, Toll pathway XM_003397996 AACGTGGAAGTCAAAGATGG GCGAACGATGACTTGGTATT 206
BGRP2 Recognition receptor, Toll pathway XM_003394713 TAACTCCCTTTGGAAACACG GGCGGTAAAATACTGAACGA 249
PGRP-S1 Recognition receptor, Imd pathway XM_003400112 TTTCCATGTTGCTCGCTTCG CGCGGTTTCCCTTTCGATATTAG 77
PGRP-LC Recognition receptor, Imd pathway XM_003396463 CAGCCACCTACGACAGATTT GTACATTCCGCTTGTGTCCT 101
PGRP-SA Recognition receptor, Toll pathway XM_003401893 CGTGAAGGAGCTCATACCAT CCAGGACTCATAGTGGCTGT 200
PGRP-SC2 Recognition receptor, Imd pathway XM_003493213 TTGGTTGGCGAAGATGGAAAC CGCGCTTGGATTATGACCAAC 132
pelle Signal molecule, Toll pathway XM_003399470 TAAATCGACCTATGCAAGCC GGGTATAGCTGCTTCTGCTG 107
relish Signal molecule, Imd pathway XM_003399472 CAGCAGTAAAAATCCCCGAC CAGCACGAATAAGTGAACATA 156
basket Signal molecule, JNK pathway XM_003402794 GGAACAAGATAATCGAGCAACTG CTGGCTTTCAATCGGTTGTG 177
hopscotch Signal molecule, JAK/STAT pathway XM_003401903 CACAGACTGAAGCAGGTTGA CATATGGGTAATTTGGTGCC 353
abaecin Antimicrobial peptide (AMP) XM_003394653 GCCACAATATGTGGAATCCT ATGACCAGGGTTTGGTAATG 141
apidaecin Antimicrobial peptide (AMP) XM_003402966 CCCGACTAATGTACCTGCCA GAAGGTGCGAATGTGTTGGA 131
defensin Antimicrobial peptide (AMP) XM_003395924 GTCTGCCTTTGTCGCAAGAC GACATTAGTCGCGTCTTCTTCG 139
hymenoptaecin Antimicrobial peptide (AMP) XR_132450 TTCATCGTACTGGCTCTCTTCTG AGCCGTAGTATTCTTCCACAGC 85
TEPA Effector molecule, JAK/STAT pathway XM_003399699 GCGTTCTATGACCACCTGTT TACAGGTTACTCCACAGCCC 212
lysozyme3 Bacteriolytic effector XM_003394052 TATGGGCAAGAAGATTCGAC GTGTACATCGTTCACGCATC 219
transferrin Iron-binding protein, antibacterial XM_003401163 CAATTTCTTCACCGCATCCT CCTCGTTATTTGGCTTGCAT 131
ferritin Iron transportation protein XM_003393332 AAAGAATTGGACGCAAATGG CAGCGAACTGATGTCCAAGA 259
serpin27a Serine protease inhibitor, prophenoloxidase cascade XM_003392985 CCGATCATCCATTCGTATTC ACCTGCACTTGATATCCCTG 164
PPO Prophenoloxidase, melanin synthesis HM142999 AGCGGCATAATACGTTGTGT CCGAGGGATAGAAAGTCTCC 329
punch Enzyme, melanin synthesis XR_131852 ATTGCCAGGACACTTTCAAC TACAAGCTGGAAACGGAAAC 211
kayak JNK pathway Bter:08277927 ACGCAATATGGGTGGCAGAA TGAACGAAGACGACAGACCG 271
serpin 3/4A Novel serine protease inhibitor XM_003399138 GCAGAGACAAATGTTGAAGCAC CACAGTCTGGGATAATGAAGAACC 78
serpin 3/4B Novel serine protease inhibitor XM_003399140 ATGGTGCTTTGTTCATCAGTCG GACCCAATGACAGCAGTAACAG 97
alaserpin Novel serine protease inhibitor XM_003399139 TGCTGAAATGCTAGATGACACG GCATATCGCTCGTTAACTCAGG 104
argonaute 2 RNA-interference, possible antiviral function XM_003398481 AATTGCAAGATCAACCTGCC CCTACCCAAAGACAAGGCAA 175
aubergine RNA-interference, possible antiviral function XM_003400641/XM_003400642 GTCGCCCTTCTGCATATCTC AAGATCGAACTGCTATCCGC 190
decay Caspase mediating apoptosis XM_003399921 AAGAAGACCTCGGTCCTTAGAC CAGCTGCAAATGAAGTAATGCG 74