Skip to main content

Table 4 Primers for ChIP

From: Methylation-dependent SOX9 expression mediates invasion in human melanoma cells and is a negative prognostic factor in advanced melanoma

Genes Primer
COL2A1-F ATCCTCCTTTGTGAGGCTTGTT
COL2A1-R AGTACGAGAGAACCCACTGGAC
p21-F TGATGTGCCACAGTTCACAA
p21-R TCCTGCCAGTTTTCCTGTTC
TMEM158-F TCTGCTGTGTTGGAGCCATT
TMEM158-R GTCTCGCCTTAGTGCTACCG
TBX3-F CTCGCCCCTTTCTTTCCCTT
TBX3-R GGGGGTGTTATGAGCCAACA
FYB-F CTCACATTGCATGGGGACG
FYB-R ATGGGCTTATCACCGGAAGG
SOX10-F CCTCTGCCTCGTGTGACTAC
SOX10-R TCCTGTCTGGAGTGGGCTG-
IP10-F GGGAAATTCCGTAACTTGGA
IP10-R AAGCCATTTTCCCTCCCTAA