Figure 9

Comparison of the dCLIP software and the Piranha software. (a,b) Motif match counts within target sites found by only one method and not the other. Targets sites were extended to 100 bp both upstream and downstream from the peak center. Then the RNA sequences covered by the target sites were scanned for matches to any 7-mer from the reverse-complement of the mature miR-124 sequence (GGCAUUCACCGCGUGCCUUA). The x-axis is the relative distance of motifs to the peak centers and the y-axis is the number of sites with motif matches. (c,d) Total motif match counts within target sites found by each method. (e,f) Targets sites were extended to 100 bp both upstream and downstream from the peak center. Then the deletion mutations were counted within the method-specific target sites in both miR-124 transfected and the control conditions. The mutation count number in the transfected condition was divided by the mean count number in the control condition to produce a relative ratio. The relative counts were then plotted for each set of method-specific sites. The x-axis is the relative distance of deletions to the peak centers and the y-axis is the relative counts.