Skip to main content

Table 1 Primers used in the various reactions

From: Quartz-Seq: a highly reproducible and sensitive single-cell RNA sequencing method, reveals non-genetic gene-expression heterogeneity

Primer Sequence 5'→'
RT primer (WTA) TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT
Tagging primer TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT
Suppression primer (NH 2 )-GTATAGAATTCGCGGCCGCTCGCGAT
TRSU AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
TRSI-2 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTT*G
TRSI-4 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTT*G
TRSI-5 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTT*G
TRSI-6 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTT*G
TRSI-7 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTT*G
TRSI-12 (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTT*G
TPC1 AATGATACGGCGACCACCGA*G
TPC2 CAAGCAGAAGACGGCATACGA*G
RT primer (qPCR) TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT
  1. qPCR, quantiative PCR, WTA, whole-transcript amplification.
  2. *Indicates phosphorothioate bonds