Skip to main content

Table 2 Newly identified microRNAs

From: Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon

Family Mature microRNA Sequence Length Abundancea
5163 Bdi-miR5163b-3p UAGAUAUUUCAGGUUGUGUGGA 22 36,348
5181 Bdi-miR5181e CGACACUUACUGUGGCUCGGA 21 277
5185 Bdi-miR5185l-3p.2 UGGAGAUUGACUUAGAAGCGG 21 360
7738 Bdi-miR7738-3p GUGCUUGACAGACGACUCUGG 21 446
7754 Bdi-miR7754-3p UUCUCUCGGCUAAGGAACUGC 21 392
9480 Bdi-miR9480ab UAUGUGAGGGUGGUAACUGAA 21 1,645
  1. aAbundance is from the sum of TP2M values from all libraries.
  2. TP2M, transcripts per 2 million.