Skip to main content

Table 6 Primers used for capillary sequencing of the 23 SNVs and for genotyping the Isl1 mutation

From: Exome sequencing identifies a missense mutation in Isl1associated with low penetrance otitis media in dearisch mice

Gene name Location Forward primer Reverse primer
1700001K19Rik 12:111907080 CTTCTTCTTCCTCTTAATTCTCTCAGG TTTAGATCCTTATGATGGTGACTCG
1700104B16Rik 8:34841236 TGTAGCAGACTGGGCTTTGC CTCCCTCAGTCCCTACAAGC
Acsl3 1:78692680 CTCTCACCTGTGTGCTCTGG CCTGATCTGCTAATGTCTGTGG
Bcl2l14 6:134377474 CTTCATCCTAAACAACCAGAAGTCC AGTGTGATTAGAGCTAGTCCTCTTCTCC
Btnl7 17:34670007 AGAGAGTTCCTGGCATGTGG CAGGCTTAGGACTGGAGACG
Catsper2 2:121223476 CTGGATGTCTTACACTCACTACACTGC CTATATGTACAGAGGGACCAGTCTTGG
Col6a3 1:92672331 CAGGCATAAAAGATGGTGTCTCTAAG GACCAAACCAACAGCAATTGTAAAC
Creb3l2 6:37284584 GATGCCCTGAGCAGAGAGG TGCAGAAAGCCAAACCTAGC
Gm10859 2:5833494 AATCTCAGTTGAGAGAAAACCTACG GAGATAGCTCAGTCAGTCAGTCAGG
Gm11149 9:49380322 GACATTCTCTAAAAGCAGAGACATCC ACGGACTACAGTCTAAAACATCTAAGC
Gtf3c2 5:31476808 CCTCAAATCCAGGCAAAGG CTCGTTGCTGTATCTCTGTGC
H2-Oa 17:34229420 CTAACCTGGACTCTGTTTCTTTTTACC CTACATTTCCACTGACTCTTTCAGAGC
Ido1 8:25703857 CCGGTAGTGGATGCTGTAGG CTCTAAGTGACCTCCGTGAGC
Isl1 13:117098488 CACTGGGCACTCTAAAGTAAACG TTCTCCGGATTTGGAGTGG
Mdc1 17:35984844 CATCTGCAGGACTGCCTAGC TGGGACTTGACCTCTTCTGC
Olfr424 1:176066876 GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGG
Olfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGTGGAGAGG
Olfr749 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC
Rsf1 7:104809403-4 GACACTAAAAGTAGAAAGCAGTCACC GCTTTTCTAGCTTTACAATGACTGG
Sap30bp 11:115825338 CAACACAGGAAATGGACACG AACCAACAGGACCCAGAGG
U1 1:172958261 TAAATACTTACCTGGCAGGAGAGATACC TTATATTGGTGCACTAGCTTCATGC