Skip to main content

Table 1 Nineteen Arabidopsis miRNA precursors from 10 miRNA families generate a total of 35 miRNA-sibling RNAs

From: Multiple distinct small RNAs originate from the same microRNA precursors

MIR Loci miRNA ID miRNA sequence Reads AGO PARE
miR159a + miR159a.1* GAGCTCCTTAAAGTTCAAACA 9   
   miR159a.2-5p AGCTGCTAAGCTATGGATCCC 36 2,7  
   miR159a.3 TAAAAAAGGATTTGGTTATA 6   
   miR159a.2-3p ATTGCATATCTCAGGAGCTTT 9 1,2,7 At5g24620
   miR159a.1* TTTGGATTGAAGGGAGCTCTA 6,587   
miR519b + miR159b.2 AGCTGCTAAGCTATGGATCCC 36 7  
   miR159b.2* ATGCCATATCTCAGGAGCTTT 14 1,2,7  
   miR159b.1 TTTGGATTGAAGGGAGCTC * 2481   
miR168a + miR168a.1 TCGCTTGGTGCAGGTCGGGAA 266,020   
   miR168a.2 ATTGGTTTGTGAGCAGGGATTGGAT 10 2  
   miR168a.1* CCCGCCTTGCATCAACTGAAT 1,497   
miR169b - miR169b.2 TGAAGTGGAGTAGAGTATAATG 7   At4g17420
   miR169b.1 CAGCCAAGGATGACTTGCCGG 4,444   
   miR169b.1* GGCAAGTTGTCCTTCGGCTACA 8   
miR169f - miR169f.2 TGAAGGAATAACGAATGGAAT 108 1  
   miR169f.1 TGAGCCAAGGATGACTTGCCG 5,779   
   miR169f.1* GCAAGTTGACCTTGGCTCTGC 2,505   
miR169i - miR169i.2-5p TGAATAGAAGAATCATATTTGG 32   
   miR169i.1 TAGCCAAGGATGACTTGCCTG 44,477   
   miR169i.1* GGCAGTCTCCTTGGCTATC 360   
   miR169i.2-3p TTATATGTTCTTCTCTTTCATC 9   At5g02710
miR169j - miR169j.1 TAGCCAAGGATGACTTGCCTG 44,458   
   miR169j.1* AATCTTGCGGGTTAGGTTTCA 9   
   miR169j.2 GGCAGTCTCCTTGGCTATC 224 4 At5g48300
miR169l - miR169l.1 TAGCCAAGGATGACTTGCCTG 44,392   
   miR169l.1* AATCTTGCGGGTTAGGTTTCA 9   
   miR169l.2 AGGCAGTCTCTTTGGCTATC 366   
miR169m - miR169m.2 TGAATAGAAGAATCATATTTGG 32   
   miR169m.1 TAGCCAAGGATGACTTGCCTG 39,650   
   miR169m.1* GGCAGTCTCCTTGGCTATC 361   
miR169n - miR169n.2* TGGCGGAAAGCGTCATGTTTAG 10 4  
   miR169n.1 TAGCCAAGGATGACTTGCCTG 44,458   
   miR169n.1* AATCTTGCGGGTTAGGTTTCA 9   
   miR169n.2 AGGCAGTCTCTTTGGCTATC 366   
miR319a + miR319a.2 AATGAATGATGCGGTAGACAAA 8 1,2,4,5  
   miR319a.1 TTGGACTGAAGGGAGCTCCCT 27   
miR319b + miR319b.1* GAGCTTTCTTCGGTCCACTC 28   
   miR319b.2 AATGAATGATGCGAGAGACAA 491 1,2  
   miR319b.1 TTGGACTGAAGGGAGCTCCCT 30   
miR447a - miR447a.2-5p ACCCCTTACAATGTCGAGTAA 106 2,4,5  
   miR447a.1 TTGGGGACGAGATGTTTTGTTG 198   
   miR447a.2-3p ACTCGATATAAGAAGGGGCTT 94 1,2,4,5,7  
   miR447a.3 TATGGAAGAAATTGTAGTATT 96 1,2,4,5,7  
miR447b - miR447b.1* AGTAAACGAAGCATCTGTCCCC 8   
   miR447b.1 TTGGGGACGAGATGTTTTGTTG 198   
   miR447b.2 ACTCGATATAAGAAGGGGCTT 94 2,5,7  
   miR447b.3 TATGGAAGAAATTGTAGTATT 96 2,4,7  
miR775 + miR775.1* GCACTACGTGACATTGAAAC 8   
   miR775.2 TTTGGTTTGTTCAAAGACATT 10 5  
   miR775.1 TTCGATGTCTAGCAGTGCCA 3,136   
miR822 +/- miR822.2* CGACCTTAAGTATAAGTAGAT 6   
   miR822.3* GATGTAACGCATGTTGTTTTCT 149 2,4,7  
   miR822.1 TGCGGGAAGCATTTGCACATGT 4,153   
   miR822.4-5p TTTCGTGGAGAATGAAATCAC 10 1,4 At1g62030, At2g04680
   miR822.5 CATACATGAATAATAATTACC 9 1,5  
   miR822.4-3p TATGATTTTATCCTCCATAAAA 11 5  
   miR822.1* ATGTGCAAATGCTTTCTACAG 693   
   miR822.3 AAACAATATACGTTGCATCCC 1,691 1,2,4,7  
   miR822.2 ATCTACTTACACTTAAGGTCG 363 1,2,4,5  
miR839 +/- miR839.2 TCATGTGAGCAGAAAGAGTAG 10 1  
   miR839.1 TACCAACCTTTCATCGTTCCC 5   
   miR839.3 TGCAAAACCGTGATAGTGCTGA 13 1,2,4,7 At1g65960
   miR839.1* GAACGCATGAGAGGTTGGTAAA 33   
miR841 - miR841.2 TGTTCTTAAGTTGCTTGTGAA 8 1  
   miR841.1 TACGAGCCACTTGAAACTGAA 59   
   miR841.1* ATTTCTAGTGGGTCGTATTCA 3,904   
miR846 + miR846.1* CATTCAAGGACTTCTATTCAG 59   
   miR846.2 AATTGGATATGATAAATGGTAA 34   
   miR846.2* ACTTTTATCATATCCCATCAG 18   
   miR846.1 TTGAATTGAAGTGCTTGAATT 37   
  1. Nineteen Arabidopsis miRNA precursors (the MIR column) from 10 miRNA families generate a total of 35 miRNA-sibling RNAs (the miRNA ID and miRNA sequence columns). For a particular precursor, the positions of newly identified miRNA-like RNAs relative to the cognate miRNA are indicated in the 'Position' column, where a plus sign (+) means that miRNA-sibling small RNAs (msRNAs) are in the upper arm of the hairpin close to the loop, a minus sign (-) indicates that they reside in the lower portion near the base of the hairpin, and '+/-' means that multiple msRNAs appear on both sides of the sibling miRNA, which is also included here. The cognate (known) miRNAs are named as miRn.1 (see the main text). The Argonaute proteins that a miRNA-like RNA can associate with are listed in the 'AGO' column. The 'PARE' column lists the mRNA genes for which a miRNA-like RNA has a corresponding small RNA target product in the three PARE/degradome datasets considered.