Skip to main content

Table 2 MicroRNAs detected by sequencing and their target gene families predicted in cotton

From: Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)

Sequence (5'-3')* Gh-miRNA Total Leaf -3 DPA 0 DPA +3 DPA Number of targets Target gene family description
UUGACAGAAGAUAGAGAGCAC 156/157 36.6 65.9 19.8 8.9 38.6 20 Squamosa promoter-binding factors, Ser/Thr protein phosphatase
UUUGGAUUGAAGGGAGCUCUA 159 11 17.5 20.9 7.2 8.6 4 Beta-ketoacyl-CoA synthase
UGCCUGGCUCCCUGUAUGCCA 160 5.5 27.1 0 1.3 0 5 Auxin response factor (ARF) family
UCGAUAAACCUCUGCAUCCAG 162 0.6 2.2 0 0 0.3 4 Allyl alcohol dehydrogenase
UGGAGAAGCAGGGCACGUGCA 164 7.9 22.7 1.1 3.4 5.1 2 NAC domain transcription factors
UCGGACCAGGCUUCAUUCCCC 165/166 3,250.5 4,058.6 7,506.8 1,928.1 2,835.4 10 Class III HD-Zip proteins
UGAAGCUGCCAGCAUGAUCUCA 167 232.9 107 22 176.2 330.5 7 Auxin response factor (ARF) family, glycoprotease
UGCUUGGUGCAGAUCGGGAC 168 144.9 72.9 5.5 7.7 242.6 4 Argonaute 1, F-box proteins
CAGCCAAGGAUGACUUGCCGG 169 0.8 4.4 0 0 0 11 Heme activating protein (HAP2), CCAAT-binding transcription factors
UGAUUGAGCCGUGCCAAUAUC 170/171 26.7 132.3 3.3 0.4 1.4 8 Hairy meristem/Scarecrow-like 6 transcription factors
AGAAUCUUGAUGAUGCUGCAU 172 51.3 193.9 15.4 8.5 20.5 21 APETALA2, AHAP2-like factors, Target of EAT1 (TOE1)
UGGACUGAAGGGAGCUCCCUC 319 0.1 0.4 0 0 0 7 TCP family transcription factors
AAGCUCAGGAGGGAUAGCGCC 390 8.1 15.3 0 11.1 5.6 11 TAS3, leucine-rich repeat transmembrane protein kinase
UCCAAAGGGAUCGCAUUGAUUU 393 3.1 0.9 0 13.2 0.6 11 Transport inhibitor response 1 (TIR-1)
UUCCACAGCUUUCUUGAACUG 396 1.4 6.1 0 0.9 0.2 31 ATCHR12 transcriptional regulator, growth regulating factors (GRF)
UCAUUGAGUGCAGCGUUGAUG 397 0.1 0.4 0 0 0 13 Laccase/copper ion binding proteins, diphenol oxidase
UGCCAAAGGAGAUUUGCCCGG 399 1.1 4.8 0 0 0.3 2 MYB family transcription factor, TIR-1
AUGCACUGCCUCUUCCCUGGC 408 0.1 0.4 0 0 0 10 Blue copper proteins, uclacyanin 3
UGUGGGAGAGUUGGGCAAGAAU 2948 3.4 10 0 1.7 2.1 5 Sucrose synthase, glucose-methanol-choline (GMC) oxidoreductase
UCUUGCCUACUCCACCCAUGCC 472/482 6.2 31.4 0.0 0.0 0.2 9 NBS-type resistance protein
UGCAUUUGCACCUGCACCUUC 530 1.9 9.6 0 0 0.2 5 C2H2 transcription factors, bHLH family protein
UGACAACGAGAGAGAGCACGU 535 11.9 45.9 1.1 1.3 5.1 4 Squamosa promoter-binding factors
UUAGAUGACCAUCAACAAACA 827 0.3 1.7 0 0 0 1 Unknown
UCUUGCUCAAAUGAGUAUUCUA 828 0.1 0.4 0 0 0 7 MYB family transcription factors
GUUUCACGUCGGGUUCACCA 894 26.8 38.9 55.1 32.4 16.2 4 Responsive to dessication 20
UAUACCGUGCCCAUGACUGUAG 2947 11.2 46.3 0 1.7 3.7 1 Serine/threonine protein phosphatase
ACUUUUGAACUGGAUUUGCCGA 2949 5.7 8.3 0 6.8 5.1 6 Endosomal protein
UGGUGUGCAGGGGGUGGAAUA 2950 0.8 3.9 0 0 0.2 5 Gibberellin 3-hydroxylase/anthocyanidin synthase
UUGGACAGAGUAAUCACGGUCG GhmiRcand1 3,683.5 5,684 14,594.7 311.6 2,638.9 3 NAC domain transcription factors
  1. *Most abundant variant shown. Gh: Gossypium hirsutum; The miR2947 precursor was derived from a G. arboreum EST. Abundance is normalized to transcripts per quarter million (TPQ) and rounded to nearest tenth.