Skip to main content

Table 1 Validated locust-specific miRNAs

From: Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust

miRNA family Mature miRNA sequence (5'-3') Length* miRNA star sequence (5'-3')
lmi-novel-01 UCAGGAAAUCAAUCGUGUAAGU 22 UUACACAGCUGGUUUCCUGGGA
lmi-novel-02 UGAAGCUCCUCAUAUCUGACCU 22 GUGAGAUGUGAUGAGCUUCACU
lmi-novel-03 UAAGCUCGUCUUUCUGAGCAGU 22 UCUUCGGAGGCGUGGGUAUCCC
lmi-novel-04 UAAUCUCAUGUGGUAACUGUGA 22 CAGAUUGCCAUGUGGGGUUUCA
lmi-novel-05 AGCAUGAUCAGUGGCAUGAAUU 22 UUCGUGUGACUGCUCAUGCAAC
lmi-novel-06 AUGGUGUCAGGAAUAUGAGUCG 22 ACACAUAUUCCUGAUACUGACA
lmi-novel-07 GAAGAGAUAGAGGAGUCAACUGC 23 ACUGACUUCUCCAUCUCUUUGC
lmi-novel-08 CUGAAGUCACACGAGAGCGCCGU 23 CGCUCUCGUGUGACGUCAGGCA
lmi-novel-09 UUAUUCUGUCCGUGCCUCGAAA 22 UUUGGCAGGUGGGCAGAAUAUGU
lmi-novel-10 GUAGGCCGGCGGAAACUACUUG 22 AGGGGUUUCUUUCGGCCUCCAG
lmi-novel-11 AUGAGCAAUGUUAUUCAAAUGG 22 AUUUGAAUAUCAUUGCACAUUG
lmi-novel-12 UGAUGCUGCAGGAGUUGUUGUGU 23 AUGGUAACCCUUGAGGAGUCUUG
lmi-novel-13 ACUGACUGCCCUAUUUCUUUGC 22 GAAGAGAUAGGACAGUCAAUCU
  1. *Length of mature miRNAs in nucleotides.