Skip to main content

Table 2 Oligonucleotide primers used for DNA amplification

From: Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeast

Gene name Forward/reverse Primer
NRG1 Forward 5'-(CTCGGTCCGCCACCATGTTTTACCCATATAACTATAGTAAC)-3'
NRG1 Reverse 5'-(CTCGGACCGTTATTGTCCCTTTTTCAAATGTGTTC)-3'
PHO88 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGAATCCTCAAGTCAGTAACATC)-3'
PHO88 Reverse 5'-(CGCGGACCGTCATTCAGCCTTAACACCAGCG)-3'
SMF1 Forward 5'-(CGCGGTCCGGTTTAAACAGGCCACCATGGTGAACGTTGGTCCTTCTC)-3'
SMF1 Reverse 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3'
SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3'
SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3'
SMP1 Forward 5'-(CTCGGTCCGCCACCATGGGTAGAAGAAAAATTGAAATTGAACC)-3'
SMP1 Reverse 5'-(CTCGGACCGTTAATCTGGAGAGTTTGTCGAACTCG)-3'