Skip to main content

Table 6 Primer sequences used for real-time PCR

From: Gene expression analysis of nuclear factor I-A deficient mice indicates delayed brain maturation

Gene Forward primer Reverse primer
Car2 CTGACCACTCCGCCTCTG AGCGTACGGAAATGAGACATC
Dcx ACACCCTTGATGGAAAGCAG AGGACCACAAGCAATGAACA
DIO2 GTAGCCTTTGAACGTGTGTGCA TTCTCCAGCCAACTTCGGACT
Gabra6 TGGAAGCGGAGATTGTTGTG CAGGCGTCGATTTTAAGATGG
Gfap GCTGGAGGGCGAAGAAAAC GGCCTTCTGACACGGATTTG
Hprt GTTCTTTGCTGACCTGCTGGA TCCCCCGTTGACTGATCATT
Mag TCTCTACCCGGGATTGTCAC AGGTCCAGTTCTGGGGATTC
Mal CCTCAGTGCCTCAGTTCTGG GTGACCACGTAGGCAAACAC
Mobp CACGGATGAAAACCCAGTGAG TCACGCTTGGAGTTGAGGAAG
Mog GAATCTCCATCGGACTTTTGA GGTCCAAGAACAGGCACAAT
Nnat AGTAGACCTCGGCGAACCCT CCCAGTAAATGCAGCATTCCA
Plp1 TGCGCTGATGCCAGAATGTA GCGAAGTTGTAAGTGGCAGCA
Sox2 GCAGTTAAATTTAGGACCGTTACAA TCTCATGTTTTCCTTTTGTACAATTT
Sox4 GGACAGCGACAAGATTCCGTT TGCCCGACTTCACCTTCTTTC
Sox11 CAAGGTATTCCAGCTACTGGCC CGGCTAGACTGCTATGCACACA
TN-C GGCGTTAACTGGTTCCATTGG ATTTATGCCCGCTTACGCCTG