A BAC clone fingerprinting approach to the detection of human genome rearrangements

Table 6 Location of 17 putative small-scale aberrations identified in MCF7 clones

Aberration position and size						PCR validation
Chr.	Start (bp)	End (bp)	Size (bp)	Affected/all clones	Sampled clone*	Reaction^†	Primers	Products (bp)
1	54,737,944	54,742,444	4,500	1/1	M0025G14
2	15,468,892	15,471,992	3,100	1/1	M0015O22	D	GGGGCCCTTTAGTGCCTTAG AATTGCCAAGTCAGAGGCAG	4,686 5,251 (+565)
2	110,086,572	110,101,972	15,400	1/1	M0006P20
3	63,591,911	63,594,011	2,100	2/5	M0118E13
3	159,597,920	159,602,020	4,100	1/1	M0012G17	B	TACTTACGGCAGAGGTTGGG TCTGATTTTGGAGCTTTTGG	6,411 6,017 (-394)
4	13,455,944	13,464,544	8,600	1/1	M0004J18
5	177,652,902	177,661,002	8,100	1/1	M0019C11
10	45,658,295	45,662,695	4,400	1/1	M0021J21
18	13,660,940	13,670,040	9,100	1/1	M0040N18
19	46,075,421	46,081,021	5,600	1/1	M0005H04
20	8,877,965	8,903,965	26,000	1/1	M0013M22	A	CTTGGGTTGGGAACTGAAAG CCTCTTCTGGGACTGCTGAC	28,006 4,925 (-23,081)
20	39,042,929	39,047,029	4,100	1/1	M0011K13
20	48,823,455	48,827,555	4,100	3/21	M0107O02
20	51,886,035	51,891,935	5,900	1/1	M0089C13
20	52,157,503	52,161,003	3,500	1/1	M0004L22
20	59,158,037	59,163,037	5,000	1/2	M0141F19
X	97,281,472	97,287,472	6,000	1/1	M0018J12	C	CCCACCAATGGATTACAACC CTTGAACCTGGGAAGCAGAG	7,828 4,971 (-2,857)

Four aberrations were tested with PCR using the primers shown here. The expected primer products based on inter-primer distance on the reference genome are shown in bold, with the observed product sizes shown below. *See Additional data file 2. ^†See Figure 7.

ISSN: 1474-760X