Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer pairs used in the present study

From: Transcriptional profiling of inductive mesenchyme to identify molecules involved in prostate development and disease

Gene Forward primer Reverse primer
rScube1 GTTCTCCAGGCTTCTTCTCAGAG TACAGTGGGCAGAGCATTGG
rFGF10 CAGTGGAAATCGGAGTTGTTG ATGACGCAATGACACAGAGCT
rTBP GCGGTTTGGCTAGGTTTCTG CCTAGAGCATCCTCTTATCTCCT
hSCUBE1 ATTTGTAGGGCCGCAGGAAC CGAGTCTGGCACGAAGAGTG
hGapdh TTAGCACCCCTGGCCAAGG CTTACTCCTTGGAGGCCATG