Skip to main content

Table 1 A list of miRNAs near predicted NRSE elements in the human genome

From: Comparative sequence analysis reveals an intricate network among REST, CREBand miRNA in mediating neuronal gene expression

miRNA NRSE sequence Coordinate (hg17) Distance (bp) Host gene
mir-124a-1 TTCAGTACCGAAGACAGCGCCC chr8:9820071-9820092 -21721 -
mir-124a-2 ATCAAGACCATGGACAGCGAAC chr8:65450519-65450540 -3795 -
mir-124a-3 TTCAACACCATGGACAGCGGAT chr20:61277903-61277924 -2437 -
mir-9-1 TCCAGCACCACGGACAGCTCCC chr1:153197524-153197545 5749 -
mir-9-3 CTCAGCACCATGGCCAGGGCCC chr15:87709202-87709223 -3094 -
mir-132 ATCAGCACCGCGGACAGCGGCG chr17:1900204-1900225 -202 -
mir-212 ATCAGCACCGCGGACAGCGGCG chr17:1900204-1900225 165 -
mir-29a TTCAGCACCATGGTCAGAGCCA chr7:130007654-130007675 11117 -
mir-29b-1 TTCAGCACCATGGTCAGAGCCA chr7:130007654-130007675 11838 -
mir-135b TTCAGCACCTAGGACAGGGCCC chr1:202159913-202159934 -10778 -
mir-153-1 TTCAGCACCGCGGACAGCGCCA chr2:219998545-219998566 1060 PTPRN
mir-346 ATCAGTACCTCGGACAGCGCCA chr10:88056588-88056609 59621 GRID1
mir-218-2 TTCAGAGCCCTGGCCATAGCCA chr5:168520831-168520852 139703 SLIT3
mir-139 TTCAGCACCCTGGAGAGAGGCC chr11:72065649-72065670 -2610 PDE2A
mir-95 TTCAGAACCAAGGCCACCTTGG chr4:8205631-8205652 72958 ABLIM2
mir-455 CTCAGGACTCTGGACAGCTGTT chr9:114005656-114005677 7873 COL27A1