Table 2 Summary of the search results for the miRNA target sites enriched in the HeLa cells transfected with miR-124 vs. miR-1
From: Unraveling transcriptional control and cis-regulatory codes using the software suite GeneACT
miRNA name | Sequence | Ratio | Number of miR-124 target sites | Number of miR-1 target sites (control) |
|---|---|---|---|---|
miR-185 | UGGAGAGAAAGGCAGUUC | 3.5409836 | 6 | 1 |
amiR-124a | UUAAGGCACGCGGUGAAUGCCA | 3.5409836 | 12 | 2 |
miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU | 3.5409836 | 6 | 1 |
miR-22 | AAGCUGCCAGUUGAAGAACUGU | -1 | 8 | 0 |
miR-337 | UCCAGCUCCUAUAUGAUGCCUUU | -1 | 7 | 0 |
miR-150 | UCUCCCAACCCUUGUACCAGUG | -1 | 6 | 0 |
miR-141 | UAACACUGUCUGGUAAAGAUGG | -1 | 6 | 0 |
miR-19b | UGUGCAAAUCCAUGCAAAACUGA | -1 | 4 | 0 |
miR-200a | UAACACUGUCUGGUAACGAUGU | -1 | 3 | 0 |
miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | -1 | 3 | 0 |
miR-31 | GGCAAGAUGCUGGCAUAGCUG | -1 | 3 | 0 |