Skip to main content

Table 4 Primers used in the standard PCR analysis

From: Genomic analysis of heat-shock factor targets in Drosophila

Gene 5' primer 3' primer Product (bp)
CG3273 ACCTGGCGGAATATCACAGA ACCCCAATGTCGGATGTAGA 421
CG9746 GCGAAAACCAATCGATGTTA CGAAGCAAGATGACCTTTCC 403
CG10077 CGACCCAAAAACCAAAGTGT GATATCGGTTTTCGCCTTCA 444
CG11166 GGCCTGCGAGGAAAAGTTAT GTCGATCCCAACAGCTACAA 414
CG12876 TTTTTATTACTAACATGAACCGGTAA GCCGTTGGTTTCTCCACTT 408
CG33111 TACGCAGCGAATATCGATTG TTCTGCACGAGGGGTAGTCT 417
CG33144 CCCAATTGGAAATGAGTGCT GAATTTCCTAAATTTTGCAAGGA 441
dmt ACCATCCCCCGATCTCTAAG GCAGGCAGGAAAATCACAAT 404
EP2237 GAAAAAGGCAAAGCCATTCA CTCGGAAAAGATGGCAACAT 451
MBF1 CCAGATGGTTAAACGGCAAT GGCTCAAGGAGCTACTGAAAAA 405
veg AATTCTCGTTGCTCTCGAACT TGGAGTTCTTCTTGGCCACT 409