Skip to main content

Table 2 Primer sequences for internal control genes

From: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes

Symbol* Forward primer Reverse primer
ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA
B2M TGCTGTCTCCATGTTTGATGTATCT TCTCTGCTCCCCACCTCTAAGT
GAPD TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
HMBS GGCAATGCGGCTGCAA GGGTACCCACGCGAATCAC
HPRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT
RPL13A CCTGGAGGAGAAGAGGAAAGAGA TTGAGGACCTCTGTGTATTTGTCAA
SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG
UBC ATTTGGGTCGCGGTTCTTG TGCCTTGACATTCTCGATGGT
YWHAZ ACTTTTGGTACATTGTGGCTTCAA CCGCCAGGACAAACCAGTAT
  1. *TBP primer sequences are described in [24]. HMBS primer sequences kindly provided by E. Mensink and L. van de Locht (Nijmegen, The Netherlands).