Skip to main content

Advertisement

Table 4 Micro-exons from each of the five chromosomes, listed in order of increasing length

From: Full-length messenger RNA sequences greatly improve genome annotation

Locus Gene name cDNA accession Exon number Exon length (nucleotides) Micro-exon sequence
At5g51700 RAR1 Ceres:99615 2 of 6 3 AG<GGA>GT
At1g63290 D-ribulose-5-phosphate-3-epimerase Ceres:37843 2 of 8 5 AG<GACGG>GT
At3g01850 D-ribulose-5-phosphate-3-epimerase Ceres:2398 2 of 9 5 AG<GACGG>GT
At4g01610 Cysteine protease Ceres:20761 5 of 11 5 AG<ATCAG>GT
At5g14030 Expressed protein Ceres:16313. 5 of 6 6 AG<GCCAAG>GT
At2g38880 Putative CCAAT-binding transcription factor subunit Ceres:7805. 4 of 7 6 AG<TTGGAG>GT
At2g07340 Expressed protein Ceres:34060. 4 of 6 7 AG<GAAGAAC>GT
At2g41710 AP2 domain transcription factor Ceres:41462 3 of 9 9 AG<TTTATCTAG>GT
At2g36190 Beta-fructofuranosidase Ceres:118038 2 of 6 9 AG<ATCCAAATG>GT
At4g13720 Auxin-regulated protein Ceres:8361 4 of 8 10 AG<GGCCATACAT>GT
At4g29510 Arginine methyltransferase (pam1) Ceres:38601 2 of 9 11 AG<GAATCCATGAA>GT
At3g55260 Beta-N-acetylhexosaminidase Ceres:118286 7 of 15 17 AG<GTTTGCCAAAATGAGAG>GT
At1g80380 Auxin-regulated protein Ceres:117698 3 of 7 18 AG<GTACCTAGGTACAATAAG>GT
At3g55630 Tetrahydrofolylpolyglutamate synthase Ceres:230791. 6 of 15 18 AG<GAGAAAACCAGCAATGAG>GT
At5g61530 Auxin-regulated protein Ceres:152557 5 of 10 19 AG<GGAGTTGCCAGCTCAGATG>GT
At5g03880 Auxin-regulated protein Ceres:37668 4 of 12 19 AG<CTGTCCCTTCTGCCGGAAG>GT
*At4g23470 Expressed protein Ceres:25694. 7 of 8 19 AG<GGTTTGCGCATGTATGCAG>GT
At1g67320 Expressed protein Ceres:116252. 7 of 18 20 AG<TTGAAAACATTTACTACAAG>GT
At3g50210 Flavonol synthase Ceres:25787. 8 of 12 20 AG<TGGAGCTCACACTGACTATG>GT
At4g37680 Expressed protein Ceres: 262351. 2 of 5 21 AG<GGTTTGTCTTTCGAAATTCAG>GT
At3g60340 Palmitoyl-protein thioesterase Ceres:38539. 5 of 12 21 AG<ACATCAGTTGTTTGTGAGAAG>GT
At3g23600 Expressed protein Ceres:11339. 2 of 7 22 AG<GTTTTGAAGCTCCAAACTTAAG>GT
At5g46030 Expressed protein Ceres:15222. 4 of 5 22 AG<CTTTGACTGAAGCTATAGACAT>GT
At4g33925 Expressed protein Ceres:24360. 2 of 5 22 AG<TAACCGAAGAACAGCTCTCAAT>GT
*At4g23470 Expressed protein Ceres:25694. 2 of 8 22 AG<ATTGTTGCTTCGCGTTGTGGTG>GT
At3g13860 Chaperonin, putative Ceres:38045. 2 of 17 22 AG<CTCGTCTACTTCCAGGAAACTG>GT
At1g73180 Expressed protein Ceres:108165. 13 of 14 23 AG<TTACTTGGAATAAGCACAACAGG>GT
At5g09830 Expressed protein Ceres:37422. 2 of 3 23 AG<GAAGTCATTGACATATCTGGAGG>GT
At2g23930 Small nuclear ribonucleoprotein E Ceres:4850. 2 of 4 23 AG<GTACATGGATAAGAAGCTCCAAA>GT
At1g66940 Expressed protein Ceres:110066. 3 of 5 24 AG<AATCTAATATTAGATGGATAATAG>GT
At5g51100 Expressed protein Ceres:126592. 8 of 9 24 AG<CACGCTTACTATCTGGATTTTGAG>GT
At1g05070 Expressed protein Ceres:13725. 2 of 3 24 AG<AGCTCAGTAATGCTTCTTTTGCTG>GT
At2g32580 Expressed protein Ceres:16625. 2 of 3 24 AG<GACTCAGCAATGGTTCATTCACTG>GT
At2g29960 Cyclophilin Ceres:19211. 4 of 6 24 AG<AAAACTTCAGAGCTTTGTGCACAG>GT
At1g65220 Expressed protein Ceres:21223. 2 of 8 24 AG<CTCAAAGGAGAAGCCCACTCTCGG>GT
At5g23310 Iron superoxide dismutase 3 Ceres:26637. 7 of 8 24 AG<CACTCTTATTATCTGGACTACAAG>GT
At4g25100 Superoxide dismutase Ceres:32935. 6 of 7 24 AG<CATGCTTACTACCTTGACTTCCAG>GT
At3g55920 Cyclophilin-like protein Ceres:94608. 5 of 8 24 AG<AGAACTTTCGGTCACTTTGCACGG>GT
At1g77060 Carboxyphosphonoenol-pyruvate mutase, putative Ceres:12293. 4 of 6 25 AG<GACCAAGCATGGCCAAAGAAGTGTG>GT
At4g15900 PRL1 protein Ceres:123113. 2 of 17 25 AG<CAAGCAGATTCGTCTCAGCCATAAG>GT
At2g47640 Putative small nuclear ribonucleoprotein D2 Ceres:26123. 3 of 6 25 AG<CAAGCCAATGGAAGAGGATACCAAT>GT
At2g41630 Transcription factor IIB (TFIIB) Ceres:2657. 2 of 7 25 AG<GTTGGGACTTGTTGCAACTATCAAG>GT
At3g62840 Small nuclear ribonucleoprotein Ceres:32457. 3 of 5 25 AG<TAAACCAATGGAAGAGGATACCAAC>GT
At2g21270 Putative ubiquitin fusion-degradation protein Ceres:34470. 4 of 10 25 AG<CCACAACTTGAAAGTGGTGACAAGA>GT
At3g10330 Transcription initiation factor IIB (TFIIB) Ceres:38950. 2 of 7 25 AG<GTTGGGACTTGTTGCGACCATCAAG>GT
At1g42480 Expressed protein Ceres:42677. 7 of 9 25 AG<ATTGCTGGAGGAAACTGAAGATGAG>GT
At2g23985 Expressed protein Ceres:252843. 2 of 4 25 AG<TGTCTTGTTCAGGTGAACAAAAAAG>GT
  1. *At4g23470 contains two micro-exons.