Skip to main content

Table 8 Dyad-analysis/sweeping predictions in regions without binding sites reported in RegulonDB

From: Evaluation of thresholds for the detection of binding sites for regulatory proteins in Escherichia coliK12 DNA

Regulatory protein and genes shown to be regulated by it Above threshold Site coordinates and number of matches Site sequence
ArcA (12)    
aceB - i:-144;f:-85;m:8 TTATCAAGTATTTTTAATTAAAATGGAAATTGTTTTTGATTTTGCATTTTAAATGAGTAG
fadB - i:-96;f:-51;m:6 ATTTCTTTAATCTTTTGTTTGCATATTTTTAACACAAAATACACAC
fumA + i:-77;f:-56;m:14 TATTGTTACTCGCTTTTAACAG
fumC - i:-92;f:-53;m:10 ATTTGTTATCAAATGGTAAATAATAAGTGAGCTAAAAGTT
glpA - i:-248;f:-232;m:8 TTATTTATGATTAACAG
hyaA - i:-168;f:-150;m:12 TACGCTTTATTAACAATAC
lpdA + i:-232;f:-204;m:15 TGTTTAAAAATTGTTAACAATTTTGTAAA
sucA - i:-323;f:-300;m:5 TGTTGTTGCAACGTAATGCGTAAA
ArgR (11)    
argD - i:-63;f:-51;m:5 TTTTTATGCATAT
FNR (4)    
aspA - i:-156;f:-144;m:3 TGATCTATTTCAC
cyoA + i:-25;f:2;m:5 GATCCCGTGGAATTGAGGTCGTTAAATG
icdA + i:-306;f:-292;m:6 ATTGAACAGGATCAC
sdhC - i:-340;f:-326;m:2 GATGATTAAAAATTA
LexA (9)    
umuD + i:-57;f:11;m:24 CTGCTGGCAAGAACAGACTACTGTATATAAAAACAGTATAACTTCAGGCAGATTATTAT
    GTTGTTTATC
Lrp (1)    
livK + i:-277;f:-269;m:2 CAGCATAAT
sdaA - - -
serA - i:-146;f:-139;m:1 CAGCATAT
NarL (1)    
adhE - i:-215;f:-201;m:1 TACCCAGAAGTGAGT
caiF - - -
torC + i:-209;f:-195;m:2 TACCCCTCCTGAGTG
PurR (15)    
codB + i:-82;f:-64;m:16 ACGAAAACGATTGCTTTTT
prsA + i:-356;f:-344;m:21 GAAAACGTTTTCG
speA - i:-132;f:-119;m:6 GAAACCGGTTGCGC
  1. Sequences and positions of binding sites predicted by dyad sweeping in genes with experimental evidence for co-regulation in RegulonDB, but with no binding site experimentally identified. Genes follow the alphabetic order of the regulatory proteins, with the name of the protein separating each group. The number in parentheses after the regulator is the value of the threshold - derived from requesting best overall performance. The site coordinates are 'i' for initial base, 'f' for final position relative to the start codon. The score is given as the maximum number of matching ('m') dyads within a ROM. The number of families used was the same for any method, but we only show families where the methods provided significant results.