Skip to main content

Table 1 Molecular data of polymorphisms on 3R

From: A rapid method to map mutations in Drosophila

Predicted Genomic Base-pair Polymorphism sequence (FRT chromosome/marker chromosome) RFLP TM3
cytological fragment position within   enzyme pattern
region   genomic fragment    
82D AE003605 6135 GCGGTACCTAGAAAC [A/G]GAAATGCTGAAACAG BslI M
   17727 TTCAGATTGCACGCA [G/T]GCGCCACATAGGGTG SphI FRT
83D AE003600 130884 AAAACTATTACAGAA [T/C]TGAGTTTGTGGCTCT - M
84A AE003674 3526 CGGTTAAAATGCCCA [TG/AC]GAGCTCGGAATCCTT StyI FRT
   3559 CCCACTTCTTCCCGG [C/T]CCTCATATTTCTTTC   
84B AE003673 38157 CTGATTTTTATTGTG [C/G]TGCACCCAAGTTTTT ApaLI M
84D AE003671 10767 ATAGAGCCATATTTT [A/C]CACATTTTCGTACGG   
   10834 GTTTGTGTTTTTTGT [A/G]CCACGTTATGCATTT RsaI M
84E AE003676 2498 TTCTAGAGGAGGGTG [G/A]GACCTTTCGGAGACG AvaII FRT
  AE003677 15615 TCTGTGCTGGCAAGC [C/G]TCCCGAGCATTTGCT - FRT
84F AE003679 34211 TGAGCAACGCAAACA [A/C]TTTAATTCAAAAACA - Other
85D AE003683 140539 CTATGAGAATTTGAT [A/T]TCATATAATCGAATT EcoRV M
85E AE003684 114149 AAGTAACCATGAAAA [C/T]TGATTCCCCTTGGCT - FRT
85F AE003686 22154 CTGAGTTGAAAATTA [/CCCAAAAAGCCCTGGGCTT] MvaI FRT
    CAATGACAGTCGGCC   
86C AE003688 7272 CTTATCTCAAAATTT [/T]GGAAATTTCCCGGGA - FRT
   7290 AAATTTCCCGGGAAG [CA/AT]TGCCCGCATGCGCTG -  
86D AE003690 3998 CTCTTACATTTTTGG [C/T]CATTTTGGCGGCCCC BglI FRT
   33879 TGTTATTTATAAATA [C/T]GAGGCACATGAATTT - FRT
   33960 TCACATACAACTCCG [C/A]CATTTGAGCCCGGAC -  
86E AE003692 1660 TGCTGCCTTGAACAC [C/G]TACACGTACAATCGT RsaI M
86F AE003693 19685/19695 TTTTTGCCTTTTGCA [/T] - M
    ACGGTCGTA [G/A]TCAGGATGAGAAAAG   
87A AE003694 44195/44208 GCGAAAGTATTTTTT [T/C]CTTTTTTTTTTT [/T] - FRT
    ATCATTCACAATGGC   
   44267 CTAGGGTTGAGTGGG [C/T]GGGTGTAGGATTACC -  
87C AE003697 34839 ACATACAAGCGTACA [T/A]AAATTTATTCATATT - M
87E AE003699 18398 TCGATTCAATTCAAT [G/A]ATCAGAACCAACTGT BclI FRT
   18419/18428 AACCAACTGTCTGTG [C/T]TGCTTCCG [C/T]   
    TTCTGGTTGCAACGG   
   18446/18449 CTGGTTGCAACGGGG [C/T]GT [A/C]TGCGTGATGTCTCAC   
   18501 GTGCATAAATTTAAG [C/T]GGGCTGCGAAAAATC   
   24855/24858 TGCAGCCCCCTTATC [C/G]AG [T/C]TGCTGACTGGATTTT TaqI FRT
   24879 ACTGGATTTTTTTTT [/TTT]GTATTCCGAATCCCC   
   24992/24998 TGGCGGTCTGCGGCG [A/C]AGTCT [C/A]TGCAAACAGGCCGAG   
  AE003700 42096 GCACCTCGTTGCTCG [T/G]CGAATTCTCACGCGT TaqI M
87F AE003702 4931/4937 CTGGCACCTACTAAG [A/G]TTCTA [C/T]CGCAAGAACTCCACT HinfI FRT
88C AE003705 2531 TGCTCGGGTTCTCTT [A/G]CCGGCTTTGAAATCG - Other
88D AE003707 14391 TCATCAGGATTCTTT [C/T]GATTTCTTTGCCACA TaqI M
88F AE003709 2931/2963 GGCGGTACTAGTACT [GGTACTGGTACTGGTACTGGTACTG/A] ND* M
    GTACTGG [G/T]ACT   
89A AE003711 3499 GCATATAAATTTCCC [G/A]TTCACAACGAACCGC - FRT
   3555 GATGGCTTTGTAGTC [T/C]TAAAGTCTCTGAGCA -  
89B AE003712 2764 AAGGTGGCTAGGGTG [G/T]TGGATGCAGCTAGAT   
   2809/2820 ACAGGAAGTTCAAAC [C/T]GATAGTGTTA [G/C] AluI FRT
    CTGTCCATTGATGGA   
   2836 CTGTCCATTGATGGA [T/G]GATTTTATATACGAT   
   2895 CTTTGCGGTAGGAAA [C/T]CAAGATGAAAATGTC   
89C AE003713 20964 TTCCCATTCACATTC [A/G]CACATGCTGGGCACG   
   20984 TGCTGGGCACGAGTA [C/T]TCGCCGATATCGATC ScaI M
89E AE003715 299 CTAATGGCTCCTACG [A/G]CATTTTGCTTTCTTC   
   320 TGCTTTCTTCGAATG [T/A]TTCTGTTACCAAACT HinfI FRT
   356 GCTCCGCTCCCTCCA [T/C]TTGTATCTGTCGGAT   
90A AE003716 214757 AAAATATGTTGTACT [AG/GTTGTT]GAATGAAAAGTAAAA - FRT
   214807 ATTTTATCTATCGGG [C/A]TACTAATGGAATCTG -  
   214862 CTAATATCTAATGCT [T/A]AGCTACAATATGATG -  
90C AE003719 15267 ATCGCCTACTAAATG ND* FRT
    [GACCCAATGCCGATCCGTTTCGAGCACTTGCAGTTG/ ]AT...   
   15306 G [G/A]AGCT [A/G]TTGGCTGTT [GAC/AAT]TGCGA   
    [A/G]GATAACACACAGGAG   
90D AE003720 2929 AGTTCGATTCAGTCG [C/T]TTTGGATAGAGCTCA - FRT
   3053 ATTTCAGATGGGAAA [G/C]GCATTAGATCTTGCT -  
91B AE003723 6105 AAGTGTGCTCTGTTT [C/T]TCGTTTAAGTTACGC   
   6202/6208 GTTAAAGCTACAGTT [T/G]CAGTT ND* M
    [ACAGTTTCAGTTACAGTGA/T]CAGTTACAGTT   
   6340 AGTTATACCCCACTT [CACTT/ ]GCTCGTTTTAATAAT   
91D AE003724 200 GCACACACACACACA [CAGTT/GGT]ACTGCCCCGCCCACT RsaI FRT
91F AE003725 11172 TTATTATGACAACAT [G/C]CATCCATTAGACCCA NsiI FRT
92A AE003726 519 CTCGTCTCCCTGATC [G/A]CAATGGTAGTGGAAA BclI M
   565 TAATAATGGTAATGG [CAATGG/ ]TAATGGTAATGGTGA   
   608 CCGCCCCAACACAAC [C/T]GAGTTCGTGAGTGCG   
92D AE003729 7430 CATTCAATTGGTGGG [/G]ACCGCTTTTGCCCAA - ND
92E AE003730 9025 GGCTAATCCGTAATC [/CGTGCCCGTACCCGTACCCCTACC] ND* FRT
    CGTACCCCTACCCGT   
93B AE003733 759 GTCCTTCAAGGCAGA [/TATGGA]TATGGAAGTGCATAA - Other
93D AE003734 25325 AAAGCTAATTGATTT [C/G]CATGAAAGTGAGCCA   
   25391 TGAACTCGCTGCTCT [C/T]CCACTTATATACATC EarI FRT
93F AE003736 2695 AAACTTCAGCAACTT [C/A]AGCCGCCAACAACAA MseI FRT
  AE003737 587 TTTGCCGTTGAAGCT [GCAGCAGCAGCAGCA/ ] - Other
    GCAGCAGCAGCAGCA   
   722 ACTTTGCCAACTTCT [T/ ]GTGCCTTTTTGTGCC -  
   144616/144630 GATGCCCTACCCCCT [T/C]CTTCACTTTCGCT [AGA/TGC] - M
    AAGGGGAATGTAAAA   
94A AE003738 687 GTGGATGATGATGCC [/C]GGTTGGTGCGTTGTT ScrFI M
95A AE003743 66247 TGCAAAAAAAAAAAA [T/ ]ATATAGCTTGGCTAC - M
95B AE003744 73639 ACCGAACCGCCCAGC [/AC]CACCCACTCAACCG - Other
   98594/98607 GGACAACAATTGTAC [T/ ]CCCCCCAAGTAC [A/C]   
    CCACGAAAATTTCAT   
   98678 AATCTTGAACTCTAA [A/G]CTGGCACGTTAAGTT AluI FRT
   98714/98729 AAATAATTGTATTTT [T/G]TGTTTTATCCGTTT [CT/TTC]   
95D AE003746 239 ACAACTAGTTAAATC [C/A]AATTTCGAGCAGAGA   
    GTGAAGAAACTGGTT   
   313/323/329 TGCATTTTATCGCAT [C/T]CCCCCTCCC [C/T]CCCTT [G/A] MseI FRT
    AGGCTAACAACTTTG   
   351 ACAACTTTGGACAAC [A/G]TCCGATCATACGCAT   
96A AE003748 492 GATGTTGCTGCTGCC [T/G]TTGCTGCTGTTGCCG - M
   631 TCCATCAGACAGCAG [/CACACCAC]CACACCACCACCAAA -  
96B AE003750 11903 AACCAATCGCAACAA [CTT/GTC]GAATTATTATTTATT - Other
   12039 GACGCGTCATCACTC [C/G]GCCGGCCACCTGTGG -  
   13160 TTTTCGCTGCCCCCC [/C]ATCCCAATTCTTCTG - ND
   13198 CGCAGTTCTTCGGAC [A/T]TCTCGCTCCCTACGC -  
   13259 CGATCTATCGATCGG [G/A]CGATCGAACTGTAAC -  
96F AE003753 8873 TTGTCAACGTGGTTG [A/C]ACTCACTTGGCGACC - Other
97B AE003756 204 TAAAAATGGCAGAGG [A/G]CAATCCGCAGTTCCC - ND
   300 TTGCCTTCGTCTAAG [A/G]ACACAAGGGGTTCTC -  
   1673 CTCCGTCCTTCAGTC [/CTTCAGGC]AGTCAGTCAGTCAGT - M
97C AE003757 8170/8177 CTCTTCCTAAAGATG [C/A]TAGTTT [/T] - M
    AAGGATAGTTTGCGC   
   8245 TTTATGATTGCGTTG [G/A]GCATAAAAATGTGAA -  
   8269 ATGTGAAATATTGTT [A/G]AAGCCGAGACATTAA -  
   8883 TCACGCTCTCCTGGC [C/T]AGGATGCACATTTGC HaeIII FRT
97F AE003760 104426 TCGGTTTCGGTTTTG [C/T]CCCACTGAAAAACAT   
   104483 CGAAAAATTGGTATT [C/T]AACTAATGGGCAACG MseI M
98A AE003761 1047 CACACGAAACGTAAA [C/G]GATGCGCAGCACTTA FokI M
98B AE003762 1805 CACAATCCCAGCTCG [G/A]GTTATATAAGTCTGT XhoI FRT
  AE003763 1291 GCTTAACAAGTTGTG [G/T]CAATTGGTCGGCAAA - Other
   3570 ATAATAAAATAAAAC [T/C]CAATATCCTGGCGAG   
   3628 GCATGTGAACTATTC [G/A]ATTCGCTCATTTCAT HinfI M
98C AE003764 1318 GATAACTATATGGAT [G/T]GGATATATGGCAGGC FokI M
98D AE003767 38575 GGGGAGGAAAAGCGA [T/C]TTTTCTACTTATTTT - M
98E AE003768 13811 ATTGTCGAAACTGCT [G/A]GCTTCAAATTGAATT - ND
   13877 TCAAGCTCCACGCCT [G/A]TTGGAATTCATTTAT -  
99A AE003769 3234 AACACATTCCCTGTG [A/G]CCACCCAAGCATCCC HaeIII M
   3333 AAACTTGAACTCGAA [C/A]TGGTACGGCGAAGTG   
99C AE003771 43332 AACTATCGAGCTGGT [AAAAC/ ]A(13)   
   43486 ATACGTTTATCAGGA [G/C]CGC...   
   43492 TG[TTTATAGCGAAAATGGGGGAGGGGGGGGGTT/ ND* FRT
    AGAGGGGGGTG]GGGGTTAGAT   
99E AE003773 228 GTGAACTTGGCACTG [C/A]GGCGTGACTCAGAAA - M
100B AE003776 497 TTCCTCCCCTAAAAG [A/C]ACCGACAAATGCAGT   
   519 AAATGCAGTAGTTAG [C/G]CCAAGACATCATCTC HaeIII M
  AE003777 451 AATGTTGGCAGGACC [T/A]CTCGATGAGTTGGCT DraII FRT
100C AE003778 1549 AGAAAACCGCAGGGC [G/T]TGTGGCGCATTTCGA - FRT
100F AE003780 60202 TTACAAATTTTTTTT [/TT]ACCTAGCTTACAATT - FRT
   85827 ACATAATGAAGAGAC [T/C]ATTTGAAATATTCAT - Other
  1. All the polymorphisms analyzed between the FRT 82B chromosome and the marker chromosome are shown. The table lists the approximate cytological location, the accession number of the genomic scaffold sections, the base-pair position within the section and the sequence of the polymorphisms. In 75% of the cases, the polymorphisms are real SNPs, where one nucleotide is replaced by another. In the other 25%, the nature of the polymorphisms is more complex, and involves multiple base changes or small deletions/insertions. When the polymorphism creates an RFLP (in about 50% of the cases), the experimentally tested enzyme is shown on the right. In four cases, a 2% agarose gel could resolve the migration difference of the two PCR products (when the polymorphisms were deletions of at least 20 bp). In these cases, RFLP patterns were not tested (indicated by ND*). The last column indicates the pattern of the TM3 balancer chromosome on either RFLP or SSCP gels. M indicates that the TM3 band co-migrates with the marker chromosome and FRT, that it co-migrates with the FRT chromosome. In a few cases, the TM3 migration pattern was different from both of these chromosomes, sindicating the presence of another allele on the balancer.