Skip to main content

Table 1 TaqMan primers and probes used in this study

From: Distinct gene expression profiles of human type 1 and type 2 T helper cells

Gene Accession 1) 5' - (FAM)-probe-(TAMRA) - 3'
(human) number 2) 5' - primer 1 - 3'
   3) 5' - primer 2 - 3'
Caspase-1 M87507 1) AA GACGTGTGCGGCTTGACTTGTCC
   2) AATACTGTCAAATTCTTCATTGCAGATAAT
   3) AAGTCGGCAGAGATTTATCCAATAA
CCR1 L10918 1) TGGCCATCGTCCACGCCG
   2) TCCTGCTGACGATTGACAGGTA
   3) GTGCCCGCAAGGCAAAC
CCR2 U03882 1) AGTGCTTCGCAGATGTCCTTGATGCTC
   2) GCGTTTAATCACATTCGAGTGTTT
   3) CCACTGGCAAATTAGGGAACAA
CCR4 X85740 1) TTACTCTGCTGACACCCCCAGCTCATC
   2) CAATACTGTGGGCTCCTCCAA
   3) ATCCATGGTGGACTGCGTGTA
CCR5 U54994 1) TGCAAAAGGCTGAAGAGCATGACTGACAT
   2) GCTGGTCATCCTCATCCTGATAA
   3) ATGGCCAGGTTGAGCAGGTA
Clusterin X14728 1) TGCCAGCCGGGACACCCAG
   2) CTTCGCCTTGCGTGAGGT
   3) GAGCAGCTGAACGAGCAGTTT
FGFR X51803 1) CCGTAGCTCCATATTGGACATCCCCAG
   2) AGATAACACCAAACCAAACCGTATG
   3) GCATGCAATTTCTTTTCCATCTT
GM-CSF M11222 1) CCCCTTTGACTGCTGGGAGCCAG
   2) CCTGAAGGACTTTCTGCTTGTCA
   3) CTCATCTGGCCGGTCTCACT
IκB M69043 1) TTCTAGTGTCAGCTGGCCCAGCTGC
   2) TCTCTGGCAGCATCTGAAGGT
   3) CCCAAGCACCCGGATACAG
IL-4R X52425 1) AATGCCACTGCCCAGGCTGTCC
   2) GTGGCAGGTAAGGGCTGAGTAGA
   3) CACCTCGCAGTCCGCAGA
RANTES M21121 1) TTGGCACACACTTGGCGGTTCTTC
   2) TCCCGAACCCATTTCTTCTCT
   3) CCCAGCAGTCGTCTTTGTCA
STAT4 L78440 1) AGTCTCGCAGGATGTCAGCGAATGG
   2) GCTGAGAGCTGTAGTGTTTACCGA
   3) AATAAAGGCCGGTTGTCTGCT
TIMP-1 X03124 1) CAATTCCGACCTCGTCATCAGGGC
   2) CACCCACAGACGGCCTTCT
   3) TCTGGTGTCCCCACGAACTT
TNF-α M10988 1) CATCTTCTCGAACCCCGAGTGACAAGC
   2) TGGCCCAGGCAGTCAGA
   3) GGTTTGCTACAACATGGGCTACA
  1. Abbreviations: FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethyl-rhodamine.