Skip to main content

Table 1 Selected primers used for the amplification, cloning and sequencing of SLC4A9

From: A novel sodium bicarbonate cotransporter-like gene in an ancient duplicated region: SLC4A9at 5q31

Primer name Sequence (5' to 3')
oi-A CGGGGCTCAGGACCTTTTAATG
oi-B ACTCCTACTCCAGCTAATTC
oi-C CTCTGAATCTTCACTGTCAC
oi-D TGAAGAGGTGGACCCTGGTC
oi-E AGATGGAGGCTCCTGTAAGG
oi-F ACTCATTCAGTGGAAGTGAC
6797up CCAGGACTGAGGAGAAGTCG
5219up TTGGCAGAGGCACCCGTAGG
345F GGTCCTCTGCCTACGGGTGCC
345R GGATGACTGCTGTGATCTGTTG
5-LDA CTCGGGAAGCGCGCCATTGTGTTGGT
3-LDA ATACGACTCACTATAGGGCGAATTGGCC
Unigene F CTGCAAGGCGATTAAGTTGGGTAAC
Unigene R GTGAGCGGATAACAATTTCACACAGGAAACAGC
c67F CATTTCTGTGAATTAGCTGGAGTAG
c67R CGACTGAGCATCTGGAAGTTAAG