Skip to main content

Table 2 List of the 240 structures of protein-DNA complexes in the dataset.

From: An overview of the structures of protein-DNA complexes

PDB code DNA-binding subunits Protein name Species Resolution /Å DNA sequence
I. Helix-turn-helix group      
1. Cro and Repressor family      
1lmb* 3,4 Repressor Phage ? 1.8 -AATACCACTGGCGGTGATATTATAT-CACCGCCAGTGGTAT-
1lli A,B Repressor mutant Phage ? 2.1 -AATACCACTGGCGGTGATATTATAT-CACCGCCAGTGGTAT-
1per L,R Repressor Phage 434 2.5 AAGTACAGTTTTTCTTG-TATTATA--CAAGAAAAACTGTACT
1rpe L,R Repressor Phage 434 2.5 -TATACAATGTATCTTG-TTTGACAAACAAGATACATTGTAT-
2or1 L,R Repressor Phage 434 2.5 AAGTACAAACTTTCTTG-TATTATA--CAAGAAAGTTTGTACT
3cro L,R Cro Phage 434 2.5 AAGTACAAACTTTCTTG-TATTATA--CAAGAAAGTTTGTACT
6cro A Cro Phage ? 3.0 AAGTACAAACTTTCTTG-TATTATA-CAAGAAAGTTTGTACT
3orc A Cro Phage ? 3.0 AAGTACAAACTTTCTTG-TATTATA--CAAGAAAGTTTGTACT
2. Homeodomain family      
1fjl*† A,B,C,G Paired protein D. melanogaster 2.0 AATAATCTGATTACTGTAATCAGATTAT
1hdd C,D Engrailed homeodomain D. melanogaster 2.8 --TTTTGCCATGTAATTACCTAAATTAGGTAATTACATGGCAAA
1apl C,D Mat a-2 S. cerevisiae 2.7 --ACATGTAATTCATTTACACGCTGCGTGTAAATGAATTACATG
1yrn A,B Mat a-1/a-2 S. cerevisiae 2.5 -TACATGTAATTTATT-ACATCATATGATGTAATAAATTACATG
1au7 A1(5-76), Pit-1 POU domain R. norvegicus 2.3 TTGCGTAGCGTTACGTATATTCCGCTAATCGAT
  A2(103-160),     
  B1(5-75),     
  B2(102-161)     
1oct C1(5-75) Oct-1 POU domain H. sapiens 3.0 TGTATTGCAAATAAGGACCTTATTTGCATAC
  C1(102-161)     
2hdd A,B Engrailed homeodomain D. melanogaster 1.9 TGTTTTTGATAAGATCTTATCAAAAAC
3hdd A,B Engrailed homeodomain D. melanogaster 2.2 --TTTTGCCATGTAATTACCTAAATTAGGTAATTACATGGCAAA
9ant A,B Antennapedia homeodomain D. melanogaster 2.4 --TTTTGCCATGTAATTACCTAAATTAGGTAATTACATGGCAAA
6pax A Paired domain H. sapiens 2.5 GATGACCTAATAGGGAAAATAACACGAA
1akh A,B Mat a-1/a-2 S. cerevisiae 2.5 TACATGTAAAAATTACATCATATGA
1b72 A,B Homeodomain H. sapiens 2.35 ACTCTATGATTGATCGTAATGCGCAAACG
1b8I A,B Homeodomain D. melanogaster 2.4 TTTACGTTTAAAAGCTTAATAAACG
1mnm C,D Mat a-2 S. cerevisiae 2.25 GATTACCTAATAGGGAAATTTACACG
      * * *
3. LacI repressor family      
1wet*† A,C Purine repressor E. coli 2.6 AACGAAAACGTTTTCGT
1bdh A,C Purine repressor E. coli 2.7 TACGCAAACGTTTGCGT
1bdi A,C Purine repressor E. coli 3.0 TACGCAAACGTTTGCGT
1pnr A,C Purine repressor E. coli 2.7 AACGAAAACGTTTTCG-
2pua A,C Purine repressor E. coli 2.9 TACGCAAACGTTTGCGT
2pub A,C Purine repressor E. coli 2.7 TACGCAAACGTTTGCGT
2puc A,C Purine repressor E. coli 2.6 TACGCAAACGTTTGCGT
2pud A,C Purine repressor E. coli 2.6 TACGCAAACGTTTGCGT
2pue A,C Purine repressor E. coli 2.7 TACGCAAACGTTTGCGT
2puf A,C Purine repressor E. coli 3.0 TACGCAAACGTTTGCGT
2pug A,C Purine repressor E. coli 2.7 AACGAAAATTTTTCGT-
1vpw A,C Purine repressor E. coli 2.7 TACGCAAACGTTTGCGT
1qpz A,C Purine repressor E. coli 2.5 TACGCAAATTTTTCGT-
1zay A,C Purine repressor E. coli 2.7 TACGCAAACGTTTGCGT
      *** *** ***
4. Endonuclease Fok I family      
1fok* A Endonuclease FokI F. okeanokoites 2.8 TCGGATGATAACGCTAGTCA
5. ?d-resolvase family      
1gdt* A,B ?d-resolvase E. coli 3.0 GCAGTGTCCGATAATTTATAAA
6. Hin recombinase family      
1hcr* A Artificial Hin recombinase Artificial 1.8 TGTTTTTGATAAGA
7. RAP1 family      
1ign* A,B RAP1 S. cerevisiae 2.25 CCGCACACCCACACACCAG
8. Prd paired domain family      
1pdn* C Prd paired domain D. melanogaster 2.5 AACGTCACGGTTGAC
9. Tc3 transposase family      
1tc3* C Transposase TC3 C. elegans 2.45 AGGGGGGGTCCTATAGAACTT
10. Trp repressor family      
1trr* A,B,D,E, Trp repressor E. coli 2.4 AGCGTACTAGTACGCT
  G,H,J,K     
11. Diptheria Tox repressor family      
1ddn* A,B,C,D Diptheria Tox repressor E. coli 3.0 ATATAATTAGGATAGCTTTACCTAATTATTTTA
12. Transcription factor IIB      
1d3u* B TF IIB P. woesei 2.4 AGAGTAAAGTTTAAATACTTATAT
1vol A TF IIB H. sapiens 2.7 ------ GGCTATAAAAGGGCTG--
1c9b A,E,I,M,Q TF IIB H. sapiens 2.65 --GGGCGCCTATAAAAGGGG----
      * *****
'Winged' HTH      
13. Interferon regulatory factor      
2irf* G,H,I,J, K, L Interferon regulatory factor-2 M. musculus 2.2 AAGTGAAAGCGA
1if1 A,B Interferon regulatory factor M. musculus 3.0 AACTGTAAGCTTT
14. Catabolite gene activator protein family      
2cgp* C Catabolite gene activator E. coli 2.2 -------------------------GTCACATTAAT--------------------
1ber A,B Catabolite gene activator E. coli 2.5 --------GCGAAAAGTGTGACATATGTCACACTTTTCGGCGAAAAGTGTGACATATGTCACACTT
1cgp A,B Catabolite gene activator E. coli 3.0 ACTTTTCGGCGAAAAGTGTGACATATGTCACACTTTTCGGCGAAAAGTGTGACATAT---------
1run A,B Catabolite gene activator E. coli 2.7 --------GCGAAAAATGTGATCTAGATCACATTTTTCGGCGAAAAATGTGATCTAGATCACATTT
1ruo A,B Catabolite gene activator E. coli 2.7 --------GCGAAAAATGTGATCTAGATCACATTTTTCGGCGAAAAATGTGATCTAGATCACATTT
      ******* ************ *********** ******
15. Transcription factor family      
3hts*† B Heat shock transcription factor K. lactis 1.75 GGTTCTAGAACC----
1cf7 A,B E2F-DP H. sapiens 2.6 -ATTTTCGCGCGGTTT
      ** * **
16. Ets domain family      
1bc8* C Sap-1 H. sapiens 1.93 TACCGGAAGTAACTTCCGGT
1bc7 C Sap-1 H. sapiens 2.01 TACCGGAAGTAACTTCCGGT
1pue E,F TF PU.1 M. musculus 2.1 -AAAAAGGGGAAGTGGG---
1awc A,B GABP-a M. musculus 2.15 -AACGACCGGAAGTACACCGGA
      ** ** *
II. Zinc-coordinating group      
17. ßßa-zinc finger family      
1aay* A1(103-133), A2(134-161), A3(162-187) Zif268 zinc finger M. musculus 1.6 --AGCGTGGGCGTTACGCC-CACGC
1zaa C1(3-33), C2(34-61), C3(62-87) Zif268 zinc finger M. musculus 2.1 --AGCGTGGGCGTTACGCC-CACGC-------------
2drp A1(103-135), A2(137-164), D1(102-135), D2(137-165) Tramtrack protein D. melanogaster 2.8 AATAAGGATAACGTCCGTCGGACGTTATCCTTATTA--
1ubd C1(295-323), C2(324-351), C3(352-381), C4(382-408) Zinc finger H. sapiens 2.5 -AGGGTCTCCAATTTTGAAGCGCGCTTCAAAATGG---
1mey C1(1-31), C2(32-59), C3(60-84), F1(1-31), F2(32-59), F3(60-84), G Consensus zinc finger Artificial 2.2 ---ATGAGGCAGAACTTAGTTCTGCCTCA--------
1a1g A1(103-132), A2(133-159), A3(160186) DSNR (Zif268 variant) M. musculus 1.9 ---AGCGTGGGCGTTACGCCCACGC
1a1h " QSGR (Zif268 variant) M. musculus 1.6 ---AGCGTGGGCGTTACGCCCACGC
1a1I " RADR (Zif268 variant) M. musculus 1.9 ---AGCGTGGGCGTTACGCCCACGC
1a1j " " M. musculus 1.6 ---AGCGTGGGCGTTACGCCCACGC
1a1k " " M. musculus 2.0 ---AGCGTGGGCGTTACGCCCACGC
1a1l " Zif268 zinc finger M. musculus 2.3 ---AGCGTGGGCGTTACGCCCACGC
2gli A1(103-135) Five-zinc finger H. sapiens 2.6 ---AGCGTGGGCGTTACGCCCACGC
  A2(136-167) " " " ---TTTCGTCTTGGGTGGTCCACG
  A3(168-196) " " "  
  A4(197-228) " " "  
  A5(229-257) " " "  
18. Hormone-nuclear receptor family      
2nll* A,B Retinoic acid receptor H. sapiens 1.9 ---CAGGTCAT-TTCAGGTCAGCTGACCTGAAATGACCTG--
1hcq A,B,E,F Estrogen receptor H. sapiens 2.4 --CCAGGTCAC-AGTGACCTGCCAGGTCACTG-TGACCTG--
1glu A,B Glucococorticoid receptor R. norvegicus 2.9 --CCAGAACATCGATGTTCTGCCAGAACATCGATGTTCTG--
1lat A,B Glucococorticoid receptor R. norvegicus 1.9 TTCCAGAACATGTTCTGGATTCCAGAACAT----GTTCTGGA
1by4 A,B,C,D Retinoic acid receptor H. sapiens 2.1 ---CAGGACATCTAGTAAATTCCAGATCTTACGTTGTCTG--
1cit A Orphan nuclear receptor H. sapiens 2.7 --CCAGAACATCGAGCCTCTGCCAGAACATCGTTGTTCTG--
1a6y A,B Orphan nuclear receptor H. sapiens 2.3 -TCCAGGACATCGCTAAGCTTGCTGGTCATTGCGGTTCTG
      *** *** *****
19. Loop-sheet-helix family      
1tsr* A,B,C p53 tumor suppressor H. sapiens 2.2 TTTCCTAGACTTGCCCAATTAATAATTGGGCAAGTCTAGGAA
1tup A,B,C p53 tumor suppressor H. sapiens 2.2 TTTCCTAGACTTGCCCAATTAATAATTGGGCAAGTCTAGGAA
20. GAL4-type family:      
1zme* C,D Proline utilization S. cerevisiae 2.5 -ACGGGAAGCCAACTCCG-
1d66 A,B GAL4 S. cerevisiae 2.7 CCGGAGGACAGTCCTCCGG
      * * * *****
III. Zipper-type group      
21. Leucine zipper family      
2dgc*† A,C GCN4 S. cerevisiae 2.2 ---TGGAGATGACGTCATCTCC--
1dgc A,C GCN4 S. cerevisiae 3.0 ---TGGAGATGACGTCATCTCC--
1ysa C,D GCN4 S. cerevisiae 2.9 ---TTCCTATGAGCTCATCCAGTT
1a02 F C-Fos H. sapiens 2.7 TTGGGAAATTTCTTTCATAG----
  J C-Jun    
      * ****
22. Helix-loop-helix family      
1am9* A,B,C,D Srebp-1A H. sapiens 2.3 -TTGCAAGTGGGGTGATCCATGA---------------
1hlo A,B Max H. sapiens 2.8 -CACCACGTGGTGTGGTGCACCA---------------
1an4 A,B USF H. sapiens 2.9 AGGCCACGTGACCGG-GGTACATCCGGTGCACT-----
1an2 A,C Max M. musculus 2.9 AGGTCACGTGACCTACACCACATCCAGTGCACTGGATG
1mdy A,B,C,D Myod M. musculus 3.0 TCAACAGCTGTTGA---TCAACAGCTGTTGAC------
1a0a A,B Pho4 S. cerevisiae 2.8  
      ** ** *****
IV. Other a-helix group      
23. Papillomavirus-1 E2 family      
2bop*† A,C Papillomavirus-1 E2 Bovine 1.7 CCGACCGACGTCGGTCG
    papillomavirus   
24. Histone family      
1aoi* A,B,C,D,E,F,G,H Histone X. laevis 2.8 ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTC
      CATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGG
      AGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT
25. EBNA1 nuclear protein family      
1b3t* A,B Ebna-1 H. herpesvirus 4 2.2 GGGAAGCATAGCTTCCC
26. Skn-1 transcription factor      
1skn* P Skn-1 C. elegans 2.5 TGACAATGTCATCCC
27. Cre recombinase family      
1crx* A,B Cre recombinase Bacteriophage P1 2.4 TATAACTTCGTATAG
28. High mobility group family      
1qrv* A,B High mobility group-1 D. melanogaster 2.2 GCGATATCGC------
1ckt A High mobility group-1 R. norvegicus 2.5 CCCCTCTGGACCTTCC
      **
29. MADS box family      
1mnm* A,B Pheromone transcription S. cerevisiae 2.25 GATTACCTAATAGGGAAATTTACACG
   factor MCM-1    
V. ß-sheet group      
30. TATA box-binding family      
1ytb* B TATA box-binding protein S. cerevisiae 1.8 --GTATATAAAACGGGTGGCGTTTTATATAC-----
1ytf A TATA box-binding protein S. cerevisiae 2.5 ----TGTATGTATATAAAACGTTTTATATACATACA
1ais A TATA box-binding protein P. woesei 2.1 AACTTACTTTIIAAAGCTTGAATGAAAAATTTCA--
1cdw A TATA box-binding protein H. sapiens 1.9 CTGCTATAAAAGGCTGCAGCCTTTTATAGCAG----
1tgh A TATA box-binding protein H. sapiens 2.0 --------CGTATATATACGCGTATATATACG----
1vol B TATA-box-BP H. sapiens 2.7 ----TGATCCCTTAAACTCGCTTGTATATGA-----
1d3u A TATA-box-BP P. woesei 2.4 ---CTTAATCGCTATATCCGTTTCTATAGCTTTCA-
1c9b B,F,J,N,R TATA-box-BP H. sapiens 2.65 --GCTATAACGGTTAACGTTATTGTATAGCCAA---
      * ****
VI. ß-hairpin/ribbon group      
31. MetJ repressor protein      
1cma* A,B Met repressor E. coli 2.8 TTAGACGTCTAGACGTCTA
32. Tus replication terminator family      
1ecr* A Tus replication terminator E. coli 2.7 TTAGTTACAACATACT
33. Integration host factor family      
1ihf* A,B Integration host factor E. coli 2.5 CGGTGCAACAAATTGATAAGCAATGCTTTTTTGGC
34. Transcription factor T-domain      
1xbr* A,B T-domain X. laevis 2.5 AATTTCACACCTAGGTGTGAAAATT
35. Hyperthermophile DNA-BP.      
1azp* A Sac7D S. acidocaldarius 1.6 GCGATCGC
1azq A Sac7D S. acidocaldarius 1.94 GCGATCGC
1bnz A 7A S. acidocaldarius 2.0 GTAATTAC
1bf4 A Ss07D S. acidocaldarius 1.6 GTAATTAC
      ****
36. Arc repressor      
1bdt* A,B,C,D Arc repressor Bacteriophage P22 2.5 TATAGTAGAGTGCTTCTATCAT
1bdv A,B,C,D Arc repressor Bacteriophage P22 2.8 TATAGTAGAGTGCTTCTATCAT
1par A,B,C,D Arc repressor Bacteriophage P22 2.6 TATAGTAGAGTGCTTCTATCAT
VII. Other      
37. Rel homology region family      
1a3q* A, B NF ?B p52 H. sapiens 2.1 GATTCCCCGGGGAATTCCCC------
1nfk A,B NF-?B p50 M. musculus 2.3 GAATTCCCTGGGAATTCCC-------
1svc P,T NF-?B p50 H. sapiens 2.6 ----AGATGGGGAATCCCCTAGA---
1vkx A,B NF ?B p50/p65 M. musculus 2.9 ------CTGGGGAATTTCCCAG----
1ram A,B NF ?B p65 M. musculus 2.7 GGGACTTTCCGAAATTCCCC------
1bvo A Gambif1 TF A. gambiae 2.7 ---CGGGCTGGAAATTTCCAGCCG--
1a02 N Nfat H. sapiens 2.7 ------TTGGGAAATTTCTTTCATAG
      * *** *
38. Stat protein family      
1bf5* A Stat-1 H. sapiens 2.9 ACAGTTTCCCGTAAATGC
VIII. Enzyme group      
39. Methyltransferase family      
6mht* A Hhal methyltransferase H. haemolyticus 2.05 ---GATAGCGCTATCTGATAGCGCTATC----------
4mht A Hhal methyltransferase H. haemolyticus 2.7 ---GATAG-GCTATC-GATAGCGCTATC----------
1mht A Hhal methyltransferase H. haemolyticus 2.8 ---GATAGCGCTATCTGATAGCGCTATC----------
3mht A Hhal methyltransferase H. haemolyticus 2.7 ---GATAGCGCTATCTGATAGCGCTATC----------
5mht A HhaI methyltransferase H. haemolyticus 2.7 ---GATAGCGCTATCTGATAGCGCTATC----------
7mht A HhaI methyltransferase H. haemolyticus 2.87 ---GATAGCGCTATCTGATAGCGCTATC----------
8mht A HhaI methyltransferase H. haemolyticus 2.76 ---GATAGCGCTATCTGATAGCGCTATC----------
9mht A HhaI methyltransferase H. haemolyticus 2.87 ---GATAG-GCTATC-GATAGCGCTATC----------
10mh A HhaI methyltransferase H. haemolyticus 2.55 ---GATAGCGCTATCTGATAGCGCTATC----------
1dct A,B HaeIII methyltransferase H. aegyptus 2.8 ---ACCAGCAG-GCCACC-AGTGTCACTGGTGGCCTGCTGG
      ** ** * * ** **
40. Endonuclease PvuII family      
3pvi* A,B Endonuclease PvuII P. vulgaris 1.59 TGACCAGCTGGTC
2pvi A,B Endonuclease PvuII P. vulgaris 1.76 TGACCAGCTGGTC
1pvi A,B Endonuclease PvuII P. vulgaris 2.8 TGACCAGCTGGTC
41. Endonuclease EcoRV family      
1rva* A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT-
1rvb A,B Endonuclease EcoRV E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT-
1rvc A,B Endonuclease EcoRV E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT-
2rve A,B Endonuclease EcoRV E. coli 3.0 CGAGCTCGCGAGCTCGCGAGCTCGCGAGCTCG
4rve A,B,C,G Endonuclease EcoRV E. coli 3.0 -------GGGATATCCCGG----GATATCCC-
1rve A,B Endonuclease EcoRV E. coli 2.5 ------AAAGATATCTTAAA----GATATCTT-
1rv5 A,B Endonuclease EcoRV E. coli 2.1 ------CGGGATATCCC CGG---GATATCCC-
1bgb A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT-
1bss A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT-
1bua A,B Endonuclease EcoRV E. coli 2.15 ------AAAGACATCTT---------------
1bsu A,B Endonuclease EcoRV E. coli 2.0 ------AAAGACATCTT---------------
      ** **** *
42. Endonuclease EcoRI family      
1qps*† A,M Endonuclease EcoRI E. coli 2.5 TCGCGAATTCGCG
1eri A,C Endonuclease EcoRI E. coli 2.7 TCGCGAATTCGCG
1qrh A Endonuclease EcoRI E. coli 2.5 TCGCGAATTCGCG
1qri A Endonuclease EcoRI E. coli 2.6 TCGCGAATTCGCG
43. Endonuclease BamHI family      
3bam* A,B Endonuclease BamHI B. amyloliquefaciens 1.8 TATGGATCCATATATG
1bhm A,B Endonuclease BamHI B. amyloliquefaciens 2.2 TATGGATCCATA----
      ************
44. Endonuclease V family      
1vas* A Endonuclease V Phage T4 2.75 ATCGCGTTGCGCTTAGCGCAACGCCGA
45. Dnase I family      
2dnj* A Deoxyribonuclease I B. taurus 2.0 GCGATCGCGCGATC--
1dnk A Deoxyribonuclease I B. taurus 2.3 GGTATACGGCTATACC
      * ** * **
46. DNA mismatch endonuclease      
1cw0* A DNA mismatch endonuclease E. coli 2.3 ACGTACCTGGCTAGCTAGGTACGT
47. DNA polymerase-ß family      
1bpy* A DNA polymerase-ß H. sapiens 2.2 CCGACCACGCATCAGC
1bpx A " " 2.4 CCGACCACGCATCAGC
1bpz A " " 2.6 CCGACCACGCATCAGC
1zqa A " " 2.7 CATTAGAATCTAATG-
1zqf A " " 2.9 CATTAGAATCTAATG-
1zqi A " " 2.7 CATTAGAATCTAATG-
1zqn A " " 3.0 CATTAGAATCTAATG-
1zqp A " " 2.8 CATCTG--TCAGATG-
7ice A " " 2.8 CATCTG--TCAGATG-
7icg A " " 3.0 CATCTG--TCAGATG-
7ich A " " 2.9 CATCTG--TCAGATG-
7ici A " " 2.8 CATCTG--TCAGATG-
7ick A " " 2.9 CATCTG--TCAGATG-
7icm A " " 3.0 CATCTG--TCAGATG-
7icn A " " 2.8 CATCTG--TCAGATG-
7icp A " " 3.0 CATCTG--TCAGATG-
7icq A " " 2.9 CATCTG--TCAGATG-
7icr A " " 3.0 CATCTG--TCAGATG-
7ics A " " 2.8 CATCTG--TCAGATG-
7ict A " " 2.8 CATCTG--TCAGATG-
7icv A " " 2.8 CATCTG---CAGATG-
8ica A " " 3.0 CATTAGAATCTAATG-
8icc A " " 2.8 CATTAGAATCTAATGA
8icf A " " 2.9 CATTAGAATCTAATG-
8ici A " " 2.8 CATTAGAATCTAATGA
8ick A " " 2.7 CATTAGAATCTAATG-
8icm A " " 2.9 CATTAGAATCTAATGA
8icn A " " 2.8 CATTAGAATCTAATG-
8ico A " " 2.7 CATTAGAATCTAATGA
8icp A " " 2.9 CATTAGAATCTAATG-
8icq A " " 3.0 CATTAGAATCTAATGA
8icr A " " 2.9 CATTAGAATCTAATGA
8ics A " " 2.9 CATTAGAATCTAATGA
8icu A " " 3.0 CATTAGAATCTAATG-
8icx A " " 3.0 CATTAGAATCTAATG-
9ica A " " 3.0 CATTAGAA-CTAATG-
9icf A " " 3.0 CATTAGAT-CTAATG-
9icg A " " 3.0 CATTAGAT-CTAATG-
9ich A " " 2.9 CATTAGAT-CTAATG-
9ick A " " 2.7 CATTAGAT-CTAATG-
9icl A " " 2.8 CATTAGAT-CTAATG-
9icm A " " 2.9 CATTAGAT-CTAATG-
9icn A " " 3.0 CATTAGAATCTAATG-
9ico A " " 2.9 CATTAGAATCTAATG-
9icq A " " 2.9 CATTAGAATCTAATG-
9icr A " " 3.0 CATTAGAA-CTAATG-
9ics A " " 2.9 CATTAGAT-CTAATG-
9ict A " " 3.0 CATTAGAT-CTAATG-
9icu A " " 2.9 CATTAGAATCTAATG-
9icv A " " 2.7 CATTAGAATCTAATG-
9icw A " " 2.6 CATTAGAATCTAATG-
9icx A " " 2.6 CATTAGAATCTAATG-
9icy A " " 3.0 CATTAGAATCTAATG-
2bpf A " R. norvegicus 2.9 GGGCGCCGCGGCGCC-
      * * *
48. DNA polymerase I      
2bdp* A DNA polymerase I B. stearothermophilus 1.8 --GCATGATGCAGCATCATGC---
4bdp A DNA polymerase I B. stearothermophilus 1.8 --GCATGATGCAGCATCATGC---
1qsy A DNA polymerase I T. aquaticus 2.3 GACCACGGCGCAGGGCGCCGTGGT
1qss A DNA polymerase I T. aquaticus 2.3 GACCACGGCGCAGGGCGCCGTGGT
2ktq A DNA polymerase I T. aquaticus 2.3 GACCACGGCGCGGGCGCCGTAATC
3ktq A DNA polymerase I T. aquaticus 2.3 GACCACGGCGCGGGCGCCGTAATC
4ktq A DNA polymerase I T. aquaticus 2.5 GACCACGGCGCGGGCGCCGTAATC
1tau A DNA polymerase I T. aquaticus 3.0 -GCCATGCGGCAGTCGC-------
1d8y A DNA polymerase I E. coli 2.08 TTTTTTTTTTTTTTTTT
      ** * ** *
49. DNA polymerase T7      
1t7p* A DNA polymerase Bacteriophage 2.2 GCCAGTGCCAACCTTGGCACTGGC
1clq A DNA polymerase Bacteriophage 2.7 GCGGAACTACTAGTAGTTCCGAG
      ** * * **
50. HIV reverse transcriptase      
1hmi* A,B HIV reverse transcriptase HIV type 1 2.8 ATGGCGCCCGAACAGGAC
2hmi A,B HIV reverse transcriptase HIV type 1 2.8 ATGGCGCCCGAACAGGAC
51. Uracil-DNA glycosylase      
1ssp* E Uracil-DNA glycosylase H. sapiens 1.9 CTGTATCTTAAAGATAACAG
2ssp E Uracil-DNA glycosylase H. sapiens 2.25 CTGTATCTTAAAGATAACAG
4skn A Uracil-DNA glycosylase H. sapiens 2.9 TGGGGGCTTAAAGCCGCCC-
      * ******* *
52. 3-Methyladenine DNA glycosylase      
1bnk* A 3-Methyladenine DNA glycosylase H. H. sapiens 2.7 GACATGTTGCCTGGCAATCATGTCA
53. Homing endonuclease      
1a73* A,B, Intron-encoded P. polycephalum 1.8 -TTGACTCTCTTAAGCGAGTCA
   Endonuclease I-Ppoi    
1a74 A,B, Intron-encoded P. polycephalum 2.2 -TTGACTCTCTTAAGCGAGTCA
   Endonuclease I-Ppoi    
1cyq A,B, Intron-encoded P. polycephalum 1.93 -TTGACTCTCTTAAGCGAGTCA
   Endonuclease I-Ppoi    
1ipp A,B, Intron-encoded P. polycephalum 2.2 -TTGACTCTCTTAAGCGAGTCA
   Endonuclease I-Ppoi    
1bp7 A,B,C,D Homing endlonuclease C. reinhardtii 3.0 GCAAAACGTCGTGAGACAGTTCG
   I-CreI    
      * ** * ** ***
54. Topoisomerase I      
1a31* A Topoisomerase I H. sapiens 2.1 AAAAAGACCCTGAAAAACCCCT
1a35 A Topoisomerase I H. sapiens 2.5 AAAAAGACCCTGAAAAACCCCT
1a36 A Topoisomerase I H. sapiens 2.8 AAAAAGACTTAGAAAAATTTTT
  1. Each entry is provided with the four-digit PDB code, the name, the source, resolution and the aligned sequences of DNA to which the protein is bound in the crystal structure. Protein DNA-binding domains are identified by a single letter identifying the protein chain in the PDB file. Where more than one DNA-binding domain is contained in a single subunit, the chain is split into the individual domains. For these, the domains are labeled with the chain ID and a number and the PDB file residue numbers of the domain are given in brackets. The PDB entries are classified into 'groups' and 'families' according to the structure of the protein contained in the complex. The representative for each family, defined as the structure with the highest resolution is marked with an asterisk (*). The CAP family is an exception; the highest-resolution entry, 2cgp, contains only part of the dimer and so PDB code 1ber is used as the representative. The full coordinate files for homodimeric PDB entries that contain only half the structure were obtained from the NDB and are marked by a dagger (†). Enzyme families whose structures also qualified for another protein group are listed in all that are applicable and are marked by a double dagger (‡).