Fig. 4

DIVE discovers unexplained hyper-variability in E. coli and V. cholerae. a The anchor CCGCCATATCACCTCCGTGATGGTTGC showed the largest median effect among unannotated anchors in E. coli (\(\alpha\) = 4.22, prevalence = 5.28%). The anchor produces a unique match in E. coli O157 overlapping isomerase Arabinose 5-phosphate isomerase (kdsD). The multiple sequence alignment (CLUSTALW) of a random selection of 20 reads containing the unannotated anchor (below). The sequence consensus (black bars) is approximately 100% upstream of the anchor (light blue), whereas downstream of the anchor the sequences found across the reads diverge significantly and introduce substitutions and indels. b The unannotated anchor CCGCCATATCACCTCCGTGATGGTTGC showed the largest median effect size among unannotated anchors in V. cholerae (\(\alpha\) = 3.47, prevalence = 5.17%). The anchor produced a single match in at least one hundred NCBI accessions, all V. cholerae strains, mapping to the intergenic region between tRNA-Cys and the artP gene (arginine ABC transporter ATPase), with the former being in the direction of more target diversity. The multiple sequence alignment (CLUSTALW) of a random selection of 20 reads containing the unannotated anchor (below). The sequence consensus (black bars) is approximately 100% upstream of the anchor (light blue), whereas downstream of the anchor the sequences found across the reads diverge significantly and introduce substitutions and indels