Fig. 2

DIVE quantifies activity of mobile genetic elements and diversity-generating mechanisms. a Number of distinct transposable elements (TEs) detected by each method and number of reads containing an anchor mapping to TE detected by DIVE among unaligned reads in N. gonorrhoeae data from Durrant et al. (2020). Tn3 transposons TnXc5, TnTsp1, and TnArsp6 were most prevalent, whereas TnXAj417 and Tn3434 showed the largest median effect size (Additional file 2: Table S4). b Boxplot of the ratio of number of clusters to the number of observation (C/N) of the anchor sequence GTGTTCCCCGCGCCAGCGGGGATAAAC called by DIVE in E. coli. The target diversity in four environments (shown in blue) is significantly larger than that of the rest of environments (Methods). c Putative direct repeat TAGTGTAAATCTATAAGGTAGTAAAAC detected by DIVE in the human gut metagenomic samples. The anchor reported by DIVE is two substitutions away from a known CRISPR direct repeat, and maps to an assembly (ctAYv1) containing a phage (orange) and a genomic segment (gray) having a canonical CRISPR array, derived from Ruminococcus bromii. d Alignment of all significant anchors from the V. cholerae analysis to the six available sequences of integrative and conjugative elements (ICEs) in the ICEberg database. The annotated genes for each SXT ICE are shown above the plot (yellow genes: integrases; red genes: antibiotic resistance; mauve genes: type IV secretion systems (T4SS)). Below the ICE, a heatmap shows the coverage of anchors with respect to the element. Anchors cluster in the neighborhood of known antibiotic resistance genes in all but ICEVchBan8, where they overlap with a known transposase